Cenchrus ciliaris
speciesAt a glance
Occurrence records40 790
Data sources11
Biological traits124
DNA specimens59
eDNA detections27
Sources11 archives
Databases and archives Cenchrus ciliaris's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility40 790 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics59 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources124 traits
Occurrence & distributionGBIF40 790 records
Environmental DNA1 datasets · 7 countries27 detections
DNA & barcodingBOLD · NCBI59 specimens
Genome at a glanceCCDB1.3 Gbp
01Narrative
Cenchrus ciliaris est une espèce de la famille des Poaceae (Graminées). Elle vit dans la majeure partie de l'Afrique, le sud de l'Asie, au sud de l'Iran, et l'extrême sud de l'Europe (Sicile). Elle est parfois appelée « Cenchrus cilié ». C'est une graminée vivace qui dépasse 50 cm de haut en Australie et pouvant atteindre 1,5 m pour les variétés cultivées les plus grandes. Les feuilles sont linéaires, de 3 à 25 cm de long et 4 à 10 mm de large. Les fleurs sont regroupées en panicule de 2 à 14 cm de long et 1 à 2.6 cm de large.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsUSDATRY
Size & morphology14
Fruit length1.15 mm
Leaf length250 mm
Leaf length max250 mm
Leaf length min30 mm
Leaf size444 mm²
Leaf width6 mm
Leaf width max10 mm
Leaf width min2 mm
Plant height0.955 m
⚠ sources differ — GIFT: 0.955 m · AusTraits: 0.75 m · USDA: 0.914 m · TRY: 0.34 m
Plant height max1.5 m
Plant height min0 m
Seed mass0.933 mg
⚠ sources differ — TRY: 0.933 mg · AusTraits: 0.759 mg · GIFT: 1.24 mg
Seed mass max4.38 mg
Seed mass min0.03 mg
Life cycle & reproduction33
After harvest regrowth rateRapid
Bloom periodLate Summer
Coppice potentialNo
Deciduousnessdeciduous
Dispersal typewind
Flower colouryellow
Flower conspicuousNo
Flowering endApr
Flowering startApr
Flowering timeyynnnnnnnnny
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifespan categoryLong
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formcryptophyte
Resprout abilityNo
Resprouting capacityresprouts
Seed spread rateModerate
Seedling vigorHigh
Sex typehermaphrodite
Vegetative spread rateSlow
Diet & foraging1
Parasiteindependent
Habitat & environment32
Active growth periodSummer and Fall
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatesubtropical
Climberself-supporting
Elevation max2 000 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourbrown
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid · TRY: grass
Growth form USDABunch
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Cerrado (lato sensu), Floresta Ombrófila (= Floresta Pluvial), Manguezal, Restinga
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionNo
Leaf shapelinear
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min20 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry24
Anaerobic toleranceLow
C:N ratioMedium
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceHigh
Fertility requirementLow
Fire resistantNo
Fire toleranceMedium
Frost free days min240 days
Leaf dry-matter content (LDMC)294 mg/g
Leaf n18.5 mg/g
Moisture useLow
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC4
Precipitation max28.5 in
Precipitation min14 in
Protein potentialMedium
Salinity toleranceMedium
Shade toleranceHigh
Soil pH max8.5 pH
Soil pH min6 pH
Temperature min4.5 °F
Wood density686 mg/cm³
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalHigh
Palatable graze animalHigh
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound260 000 per lb
ToxicityNone
Veneer productNo
Other traits5
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Shoot orientationprostrate
05DNA & barcoding59 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cenchrus ciliaris has left across the world's sequence archives.
At a glance
DNA specimens59
Marker genes8
GenBank sequences10
eDNA detections27
Countries9
The DNA barcodea real sequence read deposited for this species
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTGACCCTTAACAAAACAGACCGTGAACATGTCATCCATGCC …
Cenchrus ciliaris voucher Na-542 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL★rbcLa★trnL★trnL-F★ITS10★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Cenchrus ciliaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 271 400 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Cenchrus ciliaris1.27 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidydiploid inferred
Chromosome records32–562n range36median36mode20records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3614×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 +5
CCDB · ipcn-api-dl — Bir, S. S. & C. Singh. 1983. SOCGI plant chromosome number reports -- I. J. Cytol. Genet. 18: 60–61.
CCDB · ipcn-api-dl — Sinha, R. R. P., A. K. Bhardwaj & R. K. Singh. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 140–143.
CCDB · ipcn-api-dl — Valdés, B., R. Parra, A. M. Sánchez & M. D. Díaz. 1999. Números cromosómicos de plantas de Marruecos, IV. Lagascalia 21(1): 235–240.
CCDB · book-ipcn67-71 — GOULD, F.W. 1968. Chromosome numbers of Texas grasses. Canad. J. Bot. 46: 1315-1325.
CCDB · book-ipcn67-71 — REEDER, J.R. 1971. Notes on Mexican grasses IX. Miscellaneous chromosome number.s - 3. Brittonia 23: 105-117.
CCDB · book-ipcn73-74 — VAN LOON, J. 1974. A cytological investigation of flowering plants from the Canary islands. Acta Bot. Neerl. 23: 113-124.
CCDB · book-indian_vol2 — Moffett, A.A. & Hurcombe, R. 1949 ; de Wet, J.M .J. & Anderson, L.J. 1956 ; de Wet, J. M.J. 1958a, 1960a ; DeLisle, D.G. 1964 ; Gould, F.W. 1968 ; Malik, C.P. & Tripathi, R.C. 1970; Gupta, P.K. & Yashvir 1971 ; Khosla, P.K. 1972; Sharma, M.L. & Sharma, K. 1979
CCDB · book-indian_vol2 — Avdulov, N.P. (Fedorov)
CCDB · book-indian_vol2 — Gould, F.W. 1958 ; Reeder, J.R. 1971 ; Van Loon, J.C, 1974
CCDB · eflora
CCDB · Cave1956 — de Wet & Anderson
CCDB · Cave1958 — de Wet 1958a
CCDB · CromoCat 2015 — Sachdeva, S.K., V. Mehta & S. Bala. (1992). Biosystematic studies in three species of Cenchrus L. J. Cytol. Genet. 27:47-55
CCDB · CromoCat 2015 — Valdés, B., R. Parra, A. M. Sánchez & M.D. Díaz (1999a). Números cromosomáticos de plantas de Marruecos, IV. Lagascalia 21(1): 235-240.
2n 455×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-indian_vol2 +1
CCDB · ipcn-api-dl — Shanthamma, S. 1982. Apomixis in Cenchrus glaucus Mudaliar et Sundaraj. Proc. Indian Acad. Sci., B 91: 25–35.
CCDB · book-ipcn75-78 — Shanthamma et al. 1976
CCDB · book-ipcn75-78 — Shanthamma & Narayan 1976
CCDB · book-indian_vol2 — Shanthamma, C. et al. 1976
CCDB · CromoCat 2015 — Shanthamm, C., K. N. Narayan & Amthul Shukur. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LII]. Taxon 25(2/3): 345.
2n 342×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Khan, M. F. & G. M. Evans. 1997. Analysis of the breeding system and of chromosome pairing at meiosis in a population of Cenchrus ciliaris L. from District Rawalakot, Azad Kashmir--Pakistan. Cytologia 62: 31–38.
CCDB · CromoCat 2015 — Khan, M. F. & Evans, G. (1997). Analysis of the breeding system and of chromosome pairing at meiosis in a population of Cenchrus ciliaris L. from District Rawalakot, Azad Kashmir-Pakistan. Cytologia 62:31-38
2n 352×CCDB · ipcn-api-dl · CCDB · book-indian_vol2
CCDB · ipcn-api-dl — Parihar, S. K. & S. N. Tripathi. 1989. Karyotypes of Pennisetum species. J. Indian Bot. Soc. 68: 295–299.
CCDB · book-indian_vol2 — Krishnaswamy, N. 1941
2n 422×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Sinha, R. R. P., A. K. Bhardwaj & R. K. Singh. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 140–143.
CCDB · ipcn-api-dl — Das, L. D. V. 1994. A type of Blou Buffel Grass of Tamil Nadu. Proc. Indian Sci. Congr. Assoc. 81(4A): 86.
2n 321×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Sachdeva, S.K., V. Mehta & S. Bala. (1992). Biosystematic studies in three species of Cenchrus L. J. Cytol. Genet. 27:47-55
2n 561×CCDB · book-ipcn66
CCDB · book-ipcn66 — Ponnaiya et al. 1966
n 1814×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · book-ipcn67-71 +2
CCDB · ipcn-api-dl — Bir, S. S. & M. Sahni. 1983. SOCGI plant chromosome number reports -- I. J. Cytol. Genet. 18: 58–59.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sahni. 1985. Cytological investigations on some grasses from Punjab Plain, North India. Proc. Indian Natl. Sci. Acad., B 5: 609–626.
CCDB · ipcn-api-dl — Sinha, R. R. P., A. K. Bhardwaj & R. K. Singh. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 140–143.
CCDB · ipcn-api-dl — Ferchichi, A., M. A. Nabli & J. Delay. 1994. Prospection caryologique de la famille des Poaceae en Tunisie steppique. Acta Bot. Gallica 141(3): 327–341.
CCDB · ipcn-api-dl — SHARMA, M. L. & K. Sharma. 1979. Cytological studies in the North Indian grasses. Cytologia 44: 861–872.
CCDB · ipcn-api-dl — VIJ, S. P. & J. D. CHAUDHARY. 1981. Cytological investigation in three species of Cenchrus L. (Gramineae). Cytologia 46: 661–669.
CCDB · book-ipcn72 — KHOSLA, P.K. 1972. In IOPB chromosome number reports XXXV. Taxon 21: 161-166.
CCDB · book-ipcn67-71 — MALIK, C.P., & R.C. TRIPATHI. 1970. In IOPB chromosome number reports XXVII. Taxon 19: 437-442.
CCDB · book-ipcn67-71 — GUPTA, P.K . & YASHVIR. 1971. In IOPB chromosome reports XXXII. Taxon 20: 349-356.
CCDB · Cave1958 — Gould 1958
CCDB · CromoCat 2015 — Gupta, P. K. & Yashvir (1971). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXII]. Taxon 20(2/3): 352.
CCDB · CromoCat 2015 — Khosla, P. K. & Singh, P. (1972). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXV]. Taxon 21(1): 162-163.
CCDB · CromoCat 2015 — Malik, C. P. & Tripathi, R. C. (1970). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXVII]. Taxon 19(3): 439-440.
CCDB · CromoCat 2015 — Rao, P. N. & L. B. Mwasumbi. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXX]. Taxon 30(1): 79-80.
n 161×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bir, S. S. & Chauhan, H. S. (1990a). SOCGI plant chromosome number reports-X J. Cytol. Genet. 25:147-148
n 171×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Ahsan, S. M. N., Vahidy, A. A. & Ali, S. I. (1994). Chromosome numbers and incidence of polyploidy in Panicoideae (Poaceae) from Pakistan Ann. Missouri Bot. Gard. 81(4): 775-783
n 201×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bir, S. S. & Chauhan, H. S. (1990a). SOCGI plant chromosome number reports-X J. Cytol. Genet. 25:147-148
n 271×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Du Plessis, H. & J. J. Spies. 1988. Chromosome studies on African plants. 8. Bothalia 18: 119–122.
n 321×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bir, S. S. & Chauhan, H. S. (1990a). SOCGI plant chromosome number reports-X J. Cytol. Genet. 25:147-148
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type40 790 records
Wild obs. + sensor34 179
Museum / vouchered5 193
Cultivated / captive84
Other1 334
Origin
Native114
Introduced22 038
Range
Area of Occupancy AOO47 896 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy96% within 1 km
≤100 m 26 574≤1 km 929≤10 km 928>10 km 229
28 660 georeferenced · 5 519 without coordinates
Open the mapobservation + sensor34 179
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy68% within 1 km
≤100 m 1 275≤1 km 453≤10 km 695>10 km 109
2 532 georeferenced · 2 661 without coordinates
Open the institutions mapphysical evidence5 193
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 2>10 km 1
3 georeferenced · 81 without coordinates
Open the mapnot free-living84
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions121 of 245 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Pretoria, ZA | 600 |
| Brisbane, AU | 400 |
| Adelaide, AU | 399 |
| Palmerston, AU | 303 |
| Kensington, AU | 261 |
| Canberra, AU | 235 |
| Saint Louis, US | 184 |
| Kew, GB | 165 |
| Mexico City, MX | 159 |
| Durango, MX | 104 |
| UNIVASFlocation not on record | 86 |
| Mount Annan, AU | 78 |
| University of Stellenboschlocation not on record | 65 |
| Olocation not on record | 65 |
| San Diego, US | 63 |
| KMCClocation not on record | 55 |
| Museo Entomologico de Leonlocation not on record | 54 |
| Bronx, US | 51 |
| MeiseBGlocation not on record | 51 |
| Laboratorio de Ictiologialocation not on record | 47 |
| Baroda, IN | 46 |
| Cape Town, ZA | 37 |
| Riverside, US | 36 |
| Adam Mickiewicz University in Poznańlocation not on record | 35 |
| Guasave, MX | 31 |
| Cape Town, ZA | 31 |
| Durban, ZA | 24 |
| Salvador, BR | 24 |
| La Paz, MX | 24 |
| València, ES | 23 |
| UFBAlocation not on record | 23 |
| Frankfurt am Main | 22 |
| Mérida, MX | 21 |
| BISHlocation not on record | 20 |
| Brasília, BR | 20 |
| EAlocation not on record | 20 |
| MAlocation not on record | 20 |
| QAUlocation not on record | 20 |
| BClocation not on record | 19 |
| Paris, FR | 19 |
| Xiamen, CN | 19 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 18 |
| Zacatecas, MX | 18 |
| ASUlocation not on record | 17 |
| San Isidro, AR | 17 |
| Juriquilla, MX | 17 |
| Montecillo, Texcoco, MX | 16 |
| Culiacán, MX | 16 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 16 |
| Mexico City, MX | 16 |
| Berlin, DE | 14 |
| Wlocation not on record | 14 |
| GZUlocation not on record | 14 |
| GBR016location not on record | 14 |
| UFERSAlocation not on record | 13 |
| Feira de Santana, BR | 13 |
| EL PASO, US | 13 |
| Zapopan, MX | 13 |
| Honolulu, US | 13 |
| Tlalnepantla, MX | 13 |
| Moscow State Universitylocation not on record | 12 |
| Torreón, MX | 10 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 10 |
| Stroud Water Research Centerlocation not on record | 10 |
| Ciudad de México, MX | 9 |
| San Angelo, US | 9 |
| JBRJlocation not on record | 9 |
| Muzaffarabad, PK | 9 |
| BIO-UNIPIlocation not on record | 9 |
| National Museums of Kenyalocation not on record | 9 |
| UFPElocation not on record | 9 |
| Austin, US | 9 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 8 |
| Addis Ababa, ET | 8 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 8 |
| Uppsala, SE | 8 |
| GMBAlocation not on record | 8 |
| WAGlocation not on record | 8 |
| Armidale, AU | 8 |
| Plocation not on record | 8 |
| Tampa, US | 8 |
| CEPLAClocation not on record | 8 |
| Hobart, AU | 7 |
| Chapingo, MX | 7 |
| Masindi, UG | 7 |
| UnBlocation not on record | 7 |
| Universidade Federal de Sergipe (UFS)location not on record | 7 |
| Edinburgh, GB | 7 |
| Arusha, TZ | 7 |
| Fortaleza, BR | 7 |
| Smithfield, AU | 7 |
| Stockholm, SE | 6 |
| James Cook Townsvillelocation not on record | 6 |
| Uniwersytet Jagiellońskilocation not on record | 6 |
| University of Hargeisalocation not on record | 6 |
| John T. Waterhouse Herbariumlocation not on record | 6 |
| University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record | 6 |
| LDlocation not on record | 6 |
| Phoenix, US | 6 |
| Auckland, NZ | 6 |
| UFRPElocation not on record | 5 |
| Aarhus, DK | 5 |
| CJBGlocation not on record | 5 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 5 |
| CIIDIRlocation not on record | 5 |
| Departamento de Sistematica e Ecologialocation not on record | 5 |
| Tsukuba, JP | 5 |
| Istituto Agrario Castelnuovolocation not on record | 5 |
| CPATSAlocation not on record | 5 |
| Universidad Nacional de Colombia (UNAL)location not on record | 5 |
| Haramaya Universitylocation not on record | 5 |
| BAYLUlocation not on record | 5 |
| Instituto de Investigação Científica Tropicallocation not on record | 4 |
| Ciudad de México, MX | 4 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 4 |
| Christchurch, NZ | 4 |
| Cenargenlocation not on record | 4 |
| Museu Paraense Emílio Goeldilocation not on record | 4 |
| Córdoba, AR | 4 |
| Antiguo Cuscatlán, SV | 4 |
| TAFORI-LSRClocation not on record | 4 |
| HACAMlocation not on record | 4 |
| Emporia, US | 4 |
| Santa Cruz de la Sierra, BO | 4 |
| Clocation not on record | 3 |
| Universidad de Caldas (UCaldas)location not on record | 3 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 3 |
| Universität Göttingenlocation not on record | 3 |
| Brasília, BR | 3 |
| XALlocation not on record | 3 |
| Entomological Society of Latvialocation not on record | 3 |
| Hazara Universitylocation not on record | 3 |
| Centro de Investigación Regional Norte Centro, Campo Experimental La Campana, Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuariaslocation not on record | 3 |
| Cambridge, US | 3 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 3 |
| Natural History Museum Rotterdamlocation not on record | 3 |
| Lubbock, US | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| Pittsburg, US | 3 |
| GJOlocation not on record | 3 |
| Ensenada, MX | 3 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 3 |
| Corrientes, AR | 3 |
| Ann Arbor, US | 3 |
| Alicante, ES | 3 |
| TAIElocation not on record | 3 |
| Chaguaramas, TT | 3 |
| DSMlocation not on record | 3 |
| UESBlocation not on record | 2 |
| La Paz, BO | 2 |
| Bogotá, D.C., CO | 2 |
| St. Augustine, TT | 2 |
| Mazatlán, MX | 2 |
| Dresden, DE | 2 |
| BDBClocation not on record | 2 |
| Odawara, JP | 2 |
| CASlocation not on record | 2 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 2 |
| LNBG$location not on record | 2 |
| Davis, US | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Autlán de Navarro, MX | 2 |
| Sevilla, ES | 2 |
| McWane Science Centerlocation not on record | 2 |
| San Luis Potosí, MX | 2 |
| UFMSlocation not on record | 2 |
| Santa Barbara, US | 2 |
| BGPAlocation not on record | 2 |
| Cruz das Almas, BR | 2 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 2 |
| Jena Microbial Resource Collectionlocation not on record | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| Université de Bordeauxlocation not on record | 2 |
| Loja, EC | 2 |
| Hermosillo, MX | 2 |
| Chicago, US | 2 |
| Managua, NI | 2 |
| Gujarat Biodiversity Gene Banklocation not on record | 2 |
| Agriculture and Agri-Food Canada, Vascular Plant Herbariumlocation not on record | 2 |
| State Herbarium of South Australialocation not on record | 2 |
| MEXUlocation not on record | 2 |
| Madison, US | 2 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 1 |
| San José, CR | 1 |
| Calabar, NG | 1 |
| International Salmonella Centre (W.H.O.)location not on record | 1 |
| Université National du Béninlocation not on record | 1 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 1 |
| UCAMlocation not on record | 1 |
| San Francisco de Campeche, MX | 1 |
| Universidad del Quindío (UniQuindío)location not on record | 1 |
| Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record | 1 |
| University of Johannesburglocation not on record | 1 |
| Vitoria, ES | 1 |
| Teresina, BR | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Irvine, US | 1 |
| Badajoz, ES | 1 |
| Granada, ES | 1 |
| University of Agriculture, Faisalabadlocation not on record | 1 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| USP-IBlocation not on record | 1 |
| Claremont, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Arizona Western Collegelocation not on record | 1 |
| Salamanca, ES | 1 |
| The University of Arizonalocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Madrid, ES | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| HNBlocation not on record | 1 |
| Karlsruhe, DE | 1 |
| South Kensington, GB | 1 |
| Québec, CA | 1 |
| Escuela Agrícola Panamericanalocation not on record | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Castelar, AR | 1 |
| Flagstaff, US | 1 |
| Morelia, MX | 1 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 1 |
| Beijing, CN | 1 |
| Rishon Le Zion, IL | 1 |
| Puebla, MX | 1 |
| UEMlocation not on record | 1 |
| Logan, US | 1 |
| Université du Lomélocation not on record | 1 |
| Podgorica, ME | 1 |
| Chongqing Museumlocation not on record | 1 |
| Pamplona, ES | 1 |
| Altos de Pipe, VE | 1 |
| Toluca, MX | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| UFPIlocation not on record | 1 |
| Barcelona, ES | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| Dekalb, US | 1 |
| Museo de Historia Natural de El Salvadorlocation not on record | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| Universidad Nacional Autónoma de Honduraslocation not on record | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| Görlitz, DE | 1 |
| BMlocation not on record | 1 |
245 institutions · 4 866 of 5 193 vouchered records shown · 327 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA27 detections
Where the DNA of Cenchrus ciliaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found27
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 27 detections have coordinates
Open the map7 countries0
Grasslandred soilSTRI plot
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median25.4 °C 16.0–29.6
Seasonal swing summer↔winter12.8 °C
Max temp (day)30.0 °C 21.3–36.2
Min temp (night)20.4 °C 10.0–23.6
Precipitation70.7 mm/mo 12.1–123
Air humidity57.2 % 40.6–59.5
Moisture balance-69.7 mm/mo -197–-32.7
Vapour deficit1,351 Pa 854–2,465
Wind speed3.00 m/s 2.60–4.70
Cloud cover33.1 % 10.5–44.8
CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.