Cenchrus americanus
(L.) Morrone · speciesAt a glance
Occurrence records699
Data sources14
Biological traits134
DNA specimens27
eDNA detections74
Sources14 archives
Databases and archives Cenchrus americanus's data was compiled from.
WikipediaWikimedia Foundation18 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility699 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI74 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics27 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources134 traits
Chemical compositionLOTUS · NPASS113 compounds
Occurrence & distributionGBIF699 records
Environmental DNA3 datasets · 9 countries74 detections
DNA & barcodingBOLD · NCBI27 specimens
Genome at a glanceCCDB · GoaT · NCBI2.3 Gbp
01Narrative
Pearl millet (Cenchrus americanus, commonly known as the synonym Pennisetum glaucum; also known as 'Bajra' in Hindi, 'Sajje' in Kannada, 'Kambu' in Tamil, 'Bajeer' in Kumaoni and 'Maiwa' in Hausa) is the most widely grown type of millet. It has been grown in Africa and the Indian subcontinent since prehistoric times. The center of diversity, and suggested area of domestication, for the crop is in the Sahel zone of West Africa. Recent archaeobotanical research has confirmed the presence of domesticated pearl millet on the Sahel zone of northern Mali between 2500 and 2000 BC.Manning, Katie, Ruth Pelling, Tom Higham, Jean-Luc Schwenniger and Dorian Q Fuller (2010) 4500-year-old domesticated pearl millet (Pennisetum glaucum) from the Tilemsi Valley, Mali: new insights into an alternative cereal domestication pathway. Journal of Archaeological Science 38 (2): 312-322Fuller, D.Q. (2003). African crops in prehistoric South Asia: a critical review. in Neumann, K., Butler, A., Kahlheber, S. (ed.) Food, Fuel and Fields. Progress in Africa Archaeobotany. Africa Praehistorica 15 series. Cologne: Heinrich-Barth-Institut, 239-271.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsUSDATRY
Size & morphology20
Fruit length3.75 mm
Inflorescence length max50 cm
Inflorescence length min20 cm
Leaf length575 mm
Leaf length max900 mm
Leaf length min800 mm
Leaf size13 282 mm²
Leaf width29.5 mm
Leaf width max50 mm
Leaf width min9 mm
Plant height2.4 m
⚠ sources differ — GIFT: 2.4 m · AusTraits: 3 m · USDA: 1.83 m · TRY: 0.38 m
Plant height generative0.436 m
Plant height max3 m
Plant height min0.04 m
Seed mass4.56 mg
⚠ sources differ — TRY: 4.56 mg · AusTraits: 7.1 mg · GIFT: 4.2 mg
Seed mass max15 mg
Seed mass min0.3 mg
Seed volume6.9 mm³
Seed volume max6.9 mm³
Seed volume min6.9 mm³
Life cycle & reproduction32
Bloom periodMid Summer
Coppice potentialNo
Deciduousnessdeciduous
Dispersal typeanimal+wind
⚠ sources differ — AusTraits: anemochory epizoochory · GIFT: anemochorous
Flower colouryellow
Flower conspicuousNo
Flowering endAug
Flowering startJun
Flowering timeyynnnnnnnnny
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formannual
Life spanannual
Lifespan categoryShort
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formtherophyte
Resprout abilityNo
Seed spread rateSlow
Seedling vigorHigh
Sex typeandromonoecious
⚠ sources differ — AusTraits: andromonoecious · GIFT: bisexual
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment32
Active growth periodSummer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 200 m
Elevation mean0 m
Elevation min5 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterModerate
Foliage textureCoarse
Fruit colourbrown
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: tussock · TRY: H
Growth form USDABunch
Habitat GIFTÁrea Antrópica
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionNo
Low growing grassNo
Mycorrhiza typePh.th.end.
Root depth min10 in
Shape and orientationErect
Small grainYes
Woodinessnon-woody
Physiology & chemistry27
Anaerobic toleranceNone
C:N ratioMedium
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementLow
Fire resistantNo
Fire toleranceNone
Frost free days min200 days
Leaf C:N ratio15.5 g/g
Leaf c436 mg/g
Leaf dry-matter content (LDMC)221 mg/g
Leaf n14.64 mg/g
Leaf p2.93 mg/g
Moisture useLow
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC4
Precipitation max50 in
Precipitation min30 in
Protein potentialMedium
Salinity toleranceNone
Shade toleranceHigh
Soil pH max6.8 pH
Soil pH min5.5 pH
Specific leaf area (SLA)32.3 mm²/mg
Temperature min-35 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalHigh
Palatable graze animalHigh
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound82 320 per lb
ToxicityNone
Veneer productNo
Other traits7
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousYes
Fruit seed persistenceNo
Inflorescencepanicle
Seeds per fruit>1000
Shoot orientationerect
03Chemical composition113 compounds
Compounds documented for Cenchrus americanus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Pimarane and Isopimarane diterpenoids41
Flavones8
Gibberellins6
Cinnamic acids and derivatives6
Cassane diterpenoids5
Documented compounds113 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Ursolic Acid | present | NPASS | |
| (1R,3aR,4S,5aR,5bR,7aR,9S,11aR,11bR,13aR,13bR)-4,9-dihydroxy-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a-carboxylic acid | present | NPASS | |
| (S)-Rosmarinic acid | present | NPASS | |
| 14-Deoxo-14-O-Acetylorthosiphol Y | present | NPASS | |
| 2-[(1S,2R,4R,4aR,6R,8R,8aS)-4-acetyloxy-8-benzoyloxy-1-(carboxymethyl)-6-ethenyl-4a-hydroxy-1,6-dimethyl-5-oxo-2,3,4,7,8,8a-hexahydronaphthalen-2-yl]-2-methylpropanoic acid | present | NPASS | |
| 2-[(1S,2R,4R,4aR,6R,8R,8aS)-4-acetyloxy-8-benzoyloxy-1-(cyanomethyl)-6-ethenyl-4a-hydroxy-1,6-dimethyl-5-oxo-2,3,4,7,8,8a-hexahydronaphthalen-2-yl]-2-methylpropanoic acid | present | NPASS | |
| 2-Propenoic acid, 3-(3,4-dihydroxyphenyl)-, ethyl ester | present | NPASS | |
| 3,4-Dihydroxycinnamic acid methyl ester | present | NPASS | |
| 3-(3,4-Dihydroxyphenyl)Prop-2-Enoic Acid | present | NPASS | |
| 5-Demethoxynobiletin | present | NPASS |
05DNA & barcoding27 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cenchrus americanus has left across the world's sequence archives.
At a glance
DNA specimens27
Marker genes5
GenBank sequences10
eDNA detections74
Countries9
The DNA barcodea real sequence read deposited for this species
TCGCGAGAAGTCCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG …
[Pennisetum] glaucum subsp. monodii isolate MI-8 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL9★rbcLa★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Cenchrus americanus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 347 200 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Cenchrus americanus2.35 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–722n range14median14mode89records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1462×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +12
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ipcn-api-dl — Janaki, S., P. Y. S. Rao, M. V. S. Rao & V. Manga. 1986. Chiasma distribution in inbred lines of pearl millet, Pennisetum americanum (L.) Leeke. Nucleus (Calcutta) 29: 23–25.
CCDB · ipcn-api-dl — Dhesi, J. S. 1980. Seasonal variation in the manifestation of desynaptic gene in pearl millet. Cytologia 45: 447–451.
CCDB · ipcn-api-dl — Rao, Y. S., S. A. Rao & M. H. Mengesha. 1993. Pachytene analysis in the genus Pennisetum (L.) Rich. Cytologia 58: 155–160.
CCDB · ipcn-api-dl — Inagaki, M. & A. Mujeeb-Kazi. 1995. Comparison of polyhaploid production frequencies in crosses of hexaploid wheat with maize, pearl millet and sorghum. Breed. Sci. 45: 157–161.
CCDB · ipcn-api-dl — Prabakaran, A. J. & P. Vaidyanathan. 1996. Computer aided image analysis of pearl millet chromosomes after Q-banding. J. Cytol. Genet. 31(1): 37–40.
CCDB · ipcn-api-dl — Vidhya, K. & A. K. F. Khan. 2003. Hybrid between Pennisetum schweinfurthii and Napier Grass. Cytologia 68: 183–190.
CCDB · ipcn-api-dl — Sukhadev, P., P. S. Janake, J. V. V. S. N. Murthy, M. V. S. Rao & V. Manga. 1985. Meiotic behaviour of multiple interchange heterozygotes in pearl millet. Cytologia 50: 347–350.
CCDB · ipcn-api-dl — Parihar, S. K. & S. N. Tripathi. 1989. Karyotypes of Pennisetum species. J. Indian Bot. Soc. 68: 295–299.
CCDB · ipcn-api-dl — Prabakaran, K. A. A. J., P. Vaidyanathan & S. R. S. Rangasamy. 1991. Quinacrine fluorescent karyotypic pattern in Pennisetum americanum (L.) Leeke. Cytologia 56: 229–232.
CCDB · ipcn-api-dl — Prabakaran, K. A. A. J., P. Vaidyanathan & S. R. S. Rangasamy. 1991. Karyomorphological variations in Pennisetum americanum (L.) Leeke. Cytologia 56: 233–238.
CCDB · ipcn-api-dl — Rao, P. N., A. Nirmala & P. Ranganadham. 1991. Cytogenetic studies of plasmodial sporocytes, chromatin disintegration, desynapsis and centromere breakage in pearl millet. Cytologia 56: 165–171.
CCDB · ipcn-api-dl — Kaul, J. & J. S. Sidhu. 1998. Giemsa stained somatic karyotype of pearl millet. J. Cytol. Genet. 33(1): 7–10.
CCDB · ipcn-api-dl — Yan, G. x., S. z. Zhang, F. h. Xue, L. y. Wang, J. f. Yun & X. q. Fu. 2000. The chromosome numbers and natural distribution of 38 forage plants in north China. Grassl. China 2000(5): 1–5.
CCDB · ipcn-api-dl — Vari, A. K. & J. G. Bhowal. 1982. Aneuploids of Pennisetum typhoides. Cytologia 47: 803–808.
CCDB · ipcn-api-dl — Jha, R. P. & R. R. P. Sinha. 1986. Studies in colchicine-induced tetraploid of Pennisetum typhoides Stapf et Hubb. J. Indian Bot. Soc. 65: 141–149.
CCDB · ipcn-api-dl — Sinha, R. R. P., A. K. Bhardwaj & R. K. Singh. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 140–143.
CCDB · ipcn-api-dl — Khalfallah, N., A. Sarr & S. Siljak-yakovlev. 1993. Karyological study of some cultivated and wild stocks of pearl millet from Africa (Pennisetum typhoides Stapf et Hubb. and P. violaceum (Lam.) L. Rich.). Caryologia 46: 127–138.
CCDB · book-ipcn67-71 — CHANDOLA, R.P., & S.N. JAIN. 1970. Karyomorphological studies in Pennisetum typhoides L. Cytologia 35: 181-196.
CCDB · book-ipcn67-71 — JAUHAR, P.P. 1970. Chromosome behaviour and fertility of the raw and evolved synthetic tetraploids of pearl Millet, Pennisetum typhoides Stapf et Hubb. Genetica 41: 407-424.
CCDB · book-ipcn75-78 — Christopher & Abraham 1976
CCDB · book-ipcn75-78 — Tyagi 1975a
CCDB · book-ipcn75-78 — Tyagi 1976
CCDB · book-ipcn73-74 — DHESI, J.S., B.S. GILL, & H.L. SHARMA. 1973. Cytological studies of desynaptic stock in pearl millet, Pennisetum typhoides (Burm.) S. and Cytologia 38: 311-316.
CCDB · book-ipcn73-74 — SINGH, U., & VARI, A.K. 1974. Occurrence of multiploid sporocyte in the inter-specific hybrid of Pennisetum typhoides s. & H. X~ orientale Rich. Chromosome Inf. Serv. 16: 13-14.
CCDB · book-indian_vol2 — Bhattacharya, B. 1974
CCDB · book-indian_vol2 — Rau, N.S. 1929a ; Rangaswami, K. 1935 ; Krishnaswamy, N. 1941, 1951 ; Krishnaswamy, l'l. & Ayyangar, R. 1941 ; Sharma, A.K. & De, D.N. 1956b } Chandola, R.P. 1959 ; Pantulu, J.V. 1960b ; Gildenhuys, P. & Brix, K. 1961, 1964 ; Gupta, P.K. 1963b, 1969a, 1971 ; Al-Fakhry, A.K. et al. 1964 ; Patil, B.b. & Singh, A. 1964; Venkateswarlu, J. & Murty, U.R.K. 1966b; Mehra P.N. et al. 1968 ; Minocha, J;L. et al. 1968 ; Ramulu, K.S. 1968; Sinha, P.K. & Roy, N. 1969; Chandola, R.P. & Jain, S.N. 1970; Jauhar, .P.P. 1970a, b ; Sethi, G. et al. 1970 ; Sisodia, K.P.S. 1970a; Rangasamy, S.R.S. 1972 ; Virmani, s.S. & Gill, B.S. 1972 ; Brar, D.S. er al. 1973 ; Dhesi, J.S .. et al. 1973 ; Gill, B.S., Sharma, H.L. & Dhesi, J.S. 1973; Lobana, K.S. & Gill, B.S. 1973 ; Bhattacharya, B. 1974 ; Tyagi, B.R. 1975 ; Chatterji, A.K. 1975 ; Christopher, J. & Abraham, A. 1976; Minocha, J.L. 1977 ; Singh, R.B. et al. 1977 ; Tyagi, B.R. 1978 ; Rao, M. V.S. 1980 1970
CCDB · book-indian_vol2 — Dhesi, J.S. 1980
CCDB · book-indian_vol2 — Rau, N.S. 1929b; Karper, R.E. & Cbisholll;l, A.T. 1936 ; Burton, G.W. 1942 ; Krishnaswamy, N. 1951
CCDB · eflora
CCDB · book-fedorov — ABAYJIOB 1931, 1937a
CCDB · book-fedorov — Krishnaswamy 1951
CCDB · book-fedorov — Rau N. 1929b
CCDB · book-fedorov — Karper, Chisholm 1936
CCDB · book-fedorov — Burton 1942
CCDB · book-fedorov — Shibata 1957
CCDB · book-fedorov — Patil B. D. et al. 1961
CCDB · book-fedorov — Rau N. 1929a
CCDB · book-fedorov — Rangaswami 1935
CCDB · book-fedorov — Krishnaswamy 1941, 1951
+15 more references
2n 3617×CCDB · iber-fl · CCDB · poland · CCDB · ipcn-api-dl +5
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. I. Gramineae, supl. 2 Queirs, M.Bol. Soc. Brot. ser. 248: 81-98(1974).
CCDB · poland — Pogan E., Wcis?o H., Izmai?ow R., Przywara L. et al. 1982 b. Further studies in chromosome numbers of Polish Angiosperms. Part XVI. Acta Biol. Cracov. Ser. Bot. 24, 159-189.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Pogan, E. 1982. Further studies in chromosome numbers of Polish angiosperms. Part XVI. Acta Biol. Cracov., Ser. Bot. 24: 159–189.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1983. Chromosome numbers in Adoxaceae, Chloranthaceae, Cupressaceae, Juncaceae, Poaceae. Bot. Zhurn. SSSR 68 (12): 1683.
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · ipcn-api-dl — Li, X. l. & R. y. Chen. 1985. The karyotype analysis of Setaria italica and S. viridis. J. Wuhan Bot. Res. 3(4): 409–412.
CCDB · ipcn-api-dl — Probatova, N. S., E. G. Rudyka & A. P. Sokolovskaya. 1996. Chromosome numbers in synanthropic plants from the Russian Far East. Bot. Žhurn. (Moscow & Leningrad) 81(5): 98–101.
CCDB · ipcn-api-dl — Gill, B. S., S. S. Bir, V. K. Singhal & Y. S. Bedi. 1980. Cytological studies on some grasses from Pachmarhi forests (Central India). J. Cytol. Genet. 15: 51–57.
CCDB · ipcn-api-dl — Javurkova, V. 1980. In Chromosome number reports LXIX. Taxon 29: 713–714.
CCDB · ipcn-api-dl — Yan, G. x., S. z. Zheng, F. h. Xue, J. f. Yun, L. y. Wang & X. q. Fu. 1995. The chromosome numbers of 35 forage species and their geographical distribution. Grassl. China 1995(1): 16–20.
CCDB · book-ipcn66 — Singh & Godward 1960
CCDB · book-indian_vol2 — Avdulov, N.P. (Fedorov) ; Tischler, G. 1934 ; Krishnaswamy, N. & Ayyangar, R. 1935b ; Rohweder, H. 1937 ; Kishimoto, E. 1938 ; Delay, C. 1947 ; Krishnaswamy, N, 1951 ; Sharma, A.K. & De, D.N. 1956b ; Chandola, R.P. 1959 ; Singh, D.N. & Godward, M.B.E. 1960 ; Platzer, H. 1962 ; Gupta, P.K. 1963b, 1971 ; Narayan, K.N. & Shanthamma, C. 1968 ; Malik, C.P. & Tripathi, . R.C. 1970; Mehra, P.N. & Remanandan, P. 1973b ; Christopher, J. & Abraham, A. 1976 ; Shanthamma, C. et al. 1976 ; Kliphuis, E. 1977; Sinha, R.V. & Gupta, P.K. 1977 ; Tomkins, D.J. & Grant, W.F. 1978 ; Javurkova, V. 1980
CCDB · Cave1956 — Sharma & De
CCDB · Cave1959 — Chandola 1959
CCDB · Cave1962 — Platzer 1962
CCDB · Cave1962 — Willweber-Kish. 1962
2n 156×CCDB · ipcn-api-dl · CCDB · book-indian_vol2
CCDB · ipcn-api-dl — Aken'ova, M. E. & H. R. Chheda. 1981. Morphology, cytology and forage potential of Pennisetum americanum (L.) K. Schum. X P. purpureum Schum. Amphidiploids. Euphytica 30: 397–404.
CCDB · ipcn-api-dl — DUJARDIN, M. 1979. Additional chromosome numbers and meiotic behaviour in tropical African grasses from western Zaire. Canad. J. Bot. 57: 864–876.
CCDB · ipcn-api-dl — Kumar, R. S., U. P. Singh, R. B. Singh & R. M. Singh. 1982. Cytomorphological behaviour of primary trisomics in pearl millet (Pennisetum americanum (L.) Leeke). Cytologia 47: 503–510.
CCDB · ipcn-api-dl — Vishnuvardhan, Z. & N. Lakshmi. 1982. A coincidence of interchange trisomy with interchange heterozygosity in pearl millett - Pennisetum americanum (L.) Leeke. Proc. Indian Acad. Sci., B 48: 405–409.
CCDB · ipcn-api-dl — Vari, A. K. & J. G. Bhowal. 1991. Origin and meiotic behaviour of two multiple interchange trisomics in pearl millet (Pennisetum americanum (L.) Leeke). Cytologia 56: 315–318.
CCDB · book-indian_vol2 — Minocha, J.L. et al. 1976 ; Tyagi, B.R. 1976 ; Vcnkateswarlu, J. & Mani, J.N.R. 1978 ; Murthy, J.V. V.S.N. et al. 1979
2n 725×CCDB · iber-fl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 +1
CCDB · iber-fl — Chromosome numbers in Iberian angiosperms. Bjorkqvist, I. & al.Bot. Not.122: 271-283(1969).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. I. Gramineae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 77-103(1973).
CCDB · book-ipcn67-71 — BJ.ORKQVIST, I . , R. VON BOTHMER, O. NILSSON: & B. NORDENSTAM. 1969. Chromosome numbers in Iberian Angiosperms. Bot. Notiser 122: 271-28;
CCDB · book-ipcn73-74 — QUEIROS, M. 1973. Contribuicao para o conhecimento citotaxonomico dj spermatophyta de Portugal. I. Gramineae, Supl. I. Bol. Soc. Brot. I 4 7 ( Ser . 2 ) : 7 7- 1 0 3 .
CCDB · book-indian_vol2 — Tarnavschi, I.T. 1948 ; BjlSrkqvist, I. et al. 1969 ; Mehra, P.N. & Sharma, M.L. 1975b
2n 213×CCDB · book-ipcn75-78 · CCDB · book-indian_vol2
CCDB · book-ipcn75-78 — Manga 1976
CCDB · book-indian_vol2 — Pantulu, J.V. 1968a
CCDB · book-indian_vol2 — Pantulu, J.V. 1968b; Rangasamy, S.R.S. 1972; Sinha, R.R.P. & Jha, R.P. 1972
2n 71×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Koduru, P. K., M. K. Rao, K. V. Lakshmi & J. Sybenga. 1984. Anther development and the orientation of the interchange quadrivalent in pearl millet. Chromosoma 90: 89–93.
2n 161×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Pantulu, J.V. & Manga, V. 1971
2n 181×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang, Z. p. An, C. b. Chen, Z. x. Qi & Y. z. Sun. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 2, Chromosome Atlas of Crops and their Wild Kindred Plants in China Relatives. Science Press, Beijing.
2n 281×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Mehra, P.N. & Surider, S. 1969
2n 341×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Avdulov, N.P. (Fedorov) ; Parodi, L.R. 1946 ; Delay, C. 1947 I
2n 451×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Narayan, K.N. & Shanthamma, C. 1968 ; Shanthamma, C. & Narayan, K.N. 1976, 1976-77
2n 681×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — . Nunez, O. 1952; Tateoka, T. 1954; DeLisle, D.G. 1963, 1964 ; Gould, F.W. & Soderstrom, T.R. 1967, 1970, 1974; Gould, F.W. 1968; Davidse, G. & Pohl, R.W. 1974
n 723×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · book-ipcn67-71 +4
CCDB · ipcn-api-dl — Vari, A. K. & J. G. Bhowal. 1987. Pachytene karyotype of diploid Pennisetum americanum L. Leeke and identification of its trisomics. Cytologia 52: 833–840.
CCDB · ipcn-api-dl — Sujatha, D. M., V. Manga, M. V. S. Rao & J. S. R. Murty. 1989. Meiotic studies in some species of Pennisetum (L.) Rich. (Poaceae). Cytologia 54: 641–652.
CCDB · ipcn-api-dl — Aken'ova, M. E. & H. R. Chheda. 1981. Morphology, cytology and forage potential of Pennisetum americanum (L.) K. Schum. X P. purpureum Schum. Amphidiploids. Euphytica 30: 397–404.
CCDB · ipcn-api-dl — DUJARDIN, M. 1979. Additional chromosome numbers and meiotic behaviour in tropical African grasses from western Zaire. Canad. J. Bot. 57: 864–876.
CCDB · ipcn-api-dl — Faruqi, S. A., H. B. Quraish & M. Inamuddin. 1987. Studies in Libyan grasses X. Chromosome number and some interesting features. Ann. Bot. (Rome) 45: 75–102.
CCDB · ipcn-api-dl — Chand, H., R. K. Grover & P. K. Sareen. 1991. Carbendazim induced chromosomal aberrations in somatic and reproductive cells of pearl-millet and sunflower. Cytologia 56: 559–566.
CCDB · ipcn-api-dl — Ahsan, S. M. N., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers and incidence of polyploidy in Panicoideae (Poaceae) from Pakistan. Ann. Missouri Bot. Gard. 81(4): 775–783.
CCDB · ipcn-api-dl — Rao, P. N., A. Nirmala & P. Ranganadham. 1991. Cytogenetic studies of plasmodial sporocytes, chromatin disintegration, desynapsis and centromere breakage in pearl millet. Cytologia 56: 165–171.
CCDB · ipcn-api-dl — Koul, K. K., R. Nagpal & A. Sharma. 2000. Chromosome behaviour in the male and female sex mother cells of wheat (Triticum aestivum L.), oat (Avena sativa L.) and pearl millet (Pennisetum americanum (L.) Leeke). Caryologia 53: 175–183.
CCDB · ipcn-api-dl — Mehra, P. N. 1982. Cytology of East Indian grasses. ý.
CCDB · ipcn-api-dl — Vari, A. K. & J. G. Bhowal. 1982. Aneuploids of Pennisetum typhoides. Cytologia 47: 803–808.
CCDB · ipcn-api-dl — Sinha, R. R. P., A. K. Bhardwaj & R. K. Singh. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 140–143.
CCDB · book-ipcn72 — GUPTA, P.K. 1971. Cytological investigations in some North Indian grasses. Genet. Iber. 23: 183-198.
CCDB · book-ipcn72 — RANGASAMY, S.R.R. 1972. Cytological studies on diploid and polyploid taxa of the genus Pennisetum Rich. Genetica 43: 257-273.
CCDB · book-ipcn67-71 — RAMULU, K.S. 1968. Meiosis and fertility in derivatives of amphiploid Pennisetum. Caryologia 21: 147-156.
CCDB · book-ipcn67-71 — JAUHAR, P.P. 1970. Haploid meiosis and its bearing on the phylogeny of pearl millet, Pennisetum typhoides Stapf et Hubb. Genetica 41: 532-540.
CCDB · book-ipcn67-71 — SETHI, G.S., H.R. KALIA, & B.S. GHAI. 1970. Cytogenetical studies of three interspecific hybrids between Pennisetum typhoides Stapf and Hubb. and P. purpureum Schumach. Cytologia 35: 96-1DT.
CCDB · book-ipcn67-71 — GUPTA, P.K. 1969. In IOPB chromosome number reports xx. Taxon 18: 213-221.
CCDB · book-ipcn75-78 — Chatterji 1975
CCDB · book-ipcn73-74 — DHESI, J.S., B.S. GILL, & H.L. SHARMA. 1973. Cytological studies of desynaptic stock in pearl millet, Pennisetum typhoides (Burm.) S. and Cytologia 38: 311-316.
CCDB · book-ipcn73-74 — LOBANA, K.S., & B.S. GILL. 1973. Pachytene chromosomes of Pennisetu1 typhoides. Cytologia 38: 713-717.
CCDB · Cave1956 — Sharma & De
CCDB · Cave1963 — Gupta 1963
n 1813×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn72 +6
CCDB · ipcn-api-dl — Gill, B. S., S. S. Bir, V. K. Singhal & Y. S. Bedi. 1980. Cytological studies on some grasses from Pachmarhi forest (Central India). J. Cytol. Genet. 15: 51–57.
CCDB · ipcn-api-dl — Sinha, R. R. P., A. K. Bhardwaj & R. K. Singh. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 140–143.
CCDB · ipcn-api-dl — Bir, S. S. & H. S. Chauhan. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 147–148.
CCDB · ipcn-api-dl — Gill, B. S., S. S. Bir, V. K. Singhal & Y. S. Bedi. 1980. Cytological studies on some grasses from Pachmarhi forests (Central India). J. Cytol. Genet. 15: 51–57.
CCDB · book-ipcn66 — Singh & Godward 1960
CCDB · book-ipcn72 — GUPTA, P.K. 1971. Cytological investigations in some North Indian grasses. Genet. Iber. 23: 183-198.
CCDB · book-ipcn67-71 — MALIK, C.P., & R.C. TRIPATHI. 1970. In IOPB chromosome number reports XXVII. Taxon 19: 437-442.
CCDB · book-ipcn75-78 — Gupta & Singh 1977
CCDB · book-ipcn75-78 — Christopher & Abraham 1976
CCDB · book-ipcn73-74 — MEHRA, P.N., & P. REMANANDAN. 1973. Cytological investigations on W. Himalayan Panicoideae. Cytologia 38: 259-270.
CCDB · Cave1956 — Sharma & De
CCDB · Cave1962 — Willweber-Kish. 1962
CCDB · Cave1963 — Gupta 1963
n 363×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · ipcn-api-dl — Koul, K. K. & R. N. Gohil. 1988. SOCGI plant chromosome number reports -- VI. J. Cytol. Genet. 23: 38–52.
CCDB · book-ipcn75-78 — Mehra & Sharma 1975a
n -131×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Rao, P. N., A. Nirmala & P. Ranganadham. 1988. A cytological study of triploidy in pearl millet. Cytologia 53: 421–425.
n 121×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Bir, S. S. & H. S. Chauhan. 1990. SOCGI plant chromosome number reports---X. J. Cytol. Genet. 25: 322–323.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness94.3% BUSCO
07Deep time~2.28 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin2.28 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type699 records
Wild obs. + sensor277
Museum / vouchered390
Cultivated / captive32
Origin
Native1
Introduced104
Range
Area of Occupancy AOO1 808 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy77% within 1 km
≤100 m 56≤1 km 67≤10 km 28>10 km 8
159 georeferenced · 118 without coordinates
Open the mapobservation + sensor277
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy37% within 1 km
≤100 m 22≤1 km 24≤10 km 57>10 km 21
124 georeferenced · 266 without coordinates
Open the institutions mapphysical evidence390
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 32 records without
Open the mapnot free-living32
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions44 of 79 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| MeiseBGlocation not on record | 27 |
| Saint Louis, US | 25 |
| Auckland, NZ | 21 |
| Dekalb, US | 18 |
| Jackson, US | 14 |
| UnBlocation not on record | 13 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 13 |
| Brisbane, AU | 13 |
| Canberra, AU | 12 |
| Tampa, US | 10 |
| Mount Annan, AU | 10 |
| Kensington, AU | 9 |
| Plocation not on record | 9 |
| Smithfield, AU | 7 |
| WAGlocation not on record | 6 |
| Bronx, US | 5 |
| Pondicherry, IN | 5 |
| Museo Entomologico de Leonlocation not on record | 5 |
| Kew, GB | 4 |
| Palmerston, AU | 4 |
| BClocation not on record | 4 |
| Blumenau, BR | 4 |
| Valdosta State Universitylocation not on record | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Lubbock, US | 3 |
| Hobart, AU | 3 |
| UFMSlocation not on record | 3 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 3 |
| Dresden, DE | 2 |
| Salvador, BR | 2 |
| University of Hamburglocation not on record | 2 |
| Campo Mourão, BR | 2 |
| UFBAlocation not on record | 2 |
| Loja, EC | 2 |
| Brasília, BR | 2 |
| Porvoo, FI | 2 |
| UTFPR-CPlocation not on record | 2 |
| BIO-UNIPIlocation not on record | 2 |
| Parkville, AU | 2 |
| Karlsruhe, DE | 2 |
| Elocation not on record | 2 |
| Cuiabá, BR | 2 |
| Fairfax, US | 2 |
| UEPAlocation not on record | 1 |
| South African National Biodiversity Institutelocation not on record | 1 |
| Beijing, CN | 1 |
| San Luis Obispo, US | 1 |
| Williamsburg, US | 1 |
| Armidale, AU | 1 |
| DSMlocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Fortaleza, BR | 1 |
| University of Zambialocation not on record | 1 |
| Honolulu, US | 1 |
| MAlocation not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Université National du Béninlocation not on record | 1 |
| Jataí / Setor Industrial, BR | 1 |
| Feira de Santana, BR | 1 |
| Brasília, BR | 1 |
| Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record | 1 |
| Berlin, DE | 1 |
| Durham, US | 1 |
| University of Stellenboschlocation not on record | 1 |
| National Natural History Collectionslocation not on record | 1 |
| St. Augustine, TT | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| Cenargenlocation not on record | 1 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 1 |
| Spearfish, US | 1 |
| Antiguo Cuscatlán, SV | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| KMCClocation not on record | 1 |
| Pocatello, US | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| Museu Paraense Emílio Goeldilocation not on record | 1 |
| Palmerston North, NZ | 1 |
| Yaoundé, CM | 1 |
| FLASlocation not on record | 1 |
79 institutions · 322 of 390 vouchered records shown · 62 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA74 detections
Where the DNA of Cenchrus americanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found74
Studies independent surveys3
Countries9
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 74 detections have coordinates
Open the map9 countries0
A weed in garden.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Measured at samplingin-field
Temperature17.6 °C 1.44–29.9
pH8.14 7.22–8.59
Conductivity45,872 µS/cm 30,400–55,308
Salinity35.6 PSU 34.0–39.7
Dissolved oxygen10.2 mg/L
Turbidity0.276 NTU 0.009–0.635
Nitrate0.505 µmol/L 0.089–6.10
Sand92.9 % 92.9–98.4
Depth2.50 m 0–500
Coastal waterPelagicSediment
40 samples with on-site data · median with range · describes the sample, not the organism
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median18.6 °C 13.0–24.6
Seasonal swing summer↔winter9.30 °C
Max temp (day)20.6 °C 15.4–27.3
Min temp (night)17.0 °C 10.0–20.3
Precipitation108 mm/mo 37.8–245
Air humidity58.1 % 55.2–61.3
Moisture balance65.2 mm/mo
Vapour deficit872 Pa 643–1,181
Wind speed3.20 m/s
Cloud cover24.9 % 16.6–52.1
CHELSA 1981–2010, ~9 km grid, at location & month of 65 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.