Celtis tournefortii

Lam. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Cannabaceae/Celtis

At a glance

Occurrence records48

Data sources9

Biological traits14

DNA specimens10

eDNA detections12

Sources9 archives

Databases and archives Celtis tournefortii's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility48 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF48 records

Environmental DNA1 datasets · 5 countries12 detections

DNA & barcodingBOLD · NCBI10 specimens

01Narrative

Celtis tournefortii, commonly known as the oriental hackberry is a deciduous tree in the genus Celtis. The species is endemic to Southeastern Europe: Ukraine, Croatia, Bulgaria, Greece (including Crete), Sicily, Montenegro, North Macedonia; Western Asia: Cyprus, northwestern Iran, northern Iraq, Turkey; and the Caucasus region: Azerbaijan. It can grow up to 6 meters in height and grows in plains and dry forests.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology2

Plant height3 m

Seed mass274 mg

Life cycle & reproduction5

Deciduousnessdeciduous

Life formtree

Life spanperennial

Lifespan years11 years

Raunkiær life formphanerophyte

Habitat & environment4

Aquaticterrestrial

Climatesubtropical

Growth formtree

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density690 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Celtis tournefortii has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes4

GenBank sequences9

eDNA detections12

Countries6

The DNA barcodea real sequence read deposited for this species

ITSAJ580087.1 ↗213 bpMacedonia

ACGT

CGTTGCCCCCCCCCCGCACCTCGCTCCGAGAGCGCGTGTTCGGGTGGGGGCGGAGATTGGCCTCCCGTGCGCGATTAGCCTCGCGGTTGG …

Celtis tournefortii ITS2, from Markova Kula, Macedonia, specimen voucher LJU, Mayer, Trpin & Wraber 78660

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS6★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type48 records

Wild obs. + sensor11

Museum / vouchered37

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 5≤1 km 5

10 georeferenced · 1 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 2≤1 km 3>10 km 1

6 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	6
LDlocation not on record	5
Dresden, DE	3
Moscow State Universitylocation not on record	2
MeiseBGlocation not on record	2
ESP003location not on record	1
Barcelona, ES	1
Sevilla, ES	1
Entomological Society of Latvialocation not on record	1
Yerevan, AM	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Wlocation not on record	1
Auckland, NZ	1
València, ES	1
Bratislava, SK	1
Jaén, ES	1
Edinburgh, GB	1
Adam Mickiewicz University in Poznańlocation not on record	1

18 institutions · 31 of 37 vouchered records shown

09Environmental DNA12 detections

Where the DNA of Celtis tournefortii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 6.20–18.1

Seasonal swing summer↔winter21.3 °C

Max temp (day)17.6 °C 10.4–21.1

Min temp (night)6.80 °C 1.10–14.9

Precipitation42.0 mm/mo 35.7–67.6

Air humidity60.4 % 55.2–62.8

Moisture balance-28.1 mm/mo -65.0–-0.4

Vapour deficit758 Pa 499–960

Wind speed2.10 m/s 0.8–3.00

Cloud cover38.3 % 37.6–49.9

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)