Celtis timorensis

Span. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Cannabaceae/Celtis

At a glance

Occurrence records371

Data sources11

Biological traits32

DNA specimens10

eDNA detections4

Sources11 archives

Databases and archives Celtis timorensis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility371 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources32 traits

Chemical compositionNPASS9 compounds

Occurrence & distributionGBIF371 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Celtis timorensis, commonly known as stinkwood or stinking wood, is a species of flowering plant in the family Cannabaceae that grows in tropical Asia. The specific epithet comes from the name of the island of Timor, the locality of the type collection.Flora of Australia Online. Celtis timorensis at Hùng Temple, Vietnam The most notable characteristic of the tree is the strong excrement odour that it emits from the bark and sap, which pervades the surrounding forest. This is due to the presence of the malodorous organic compound skatole. In Thailand, it therefore known as kæ̂ng k̄hī̂ phrar̀wng or mị̂ chĕd tūd phrar̀wng () which means 'wipe the bottom timber'. Thai legend has it that Phra Ruang (the legendary King of the Sukhothai dynasty) wiped his buttocks with it. In Sri Lanka the heartwood of the tree (known as gurenda, ගුරෙන්ද) is used as a traditional ayurvedic medicine against syphilis, chickenpox, and measles.Celtis timorensis, Ayurvedic Medicinal Plants of Sri Lanka. Accessed 15.02.2018 on http://www.instituteofayurveda.org/plants/plants_detail.php?i=1313&s=Family_name

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology10

Fruit length9 mm

⚠ sources differ — AusTraits: 9 mm · GIFT: 8.5 mm

Fruit length max9 mm

Fruit length min8 mm

Fruit width10 mm

Leaf length75 mm

Leaf width37.5 mm

Petiole length0.65 cm

Plant height10 m

⚠ sources differ — AusTraits: 10 m · TRY: 20 m

Seed length7.5 mm

Seed width7.5 mm

Life cycle & reproduction5

Deciduousnessevergreen

Flowering timennnnnnnnnnyn

Life formtree

Life spanperennial

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max140 m

Elevation mean95 m

Elevation min50 m

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Leaf compoundnesssimple

Leaf shapeoblong ovate

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density580 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition9 compounds

Compounds documented for Celtis timorensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Flavan-3-ols4

Flavan-3-ols $ Flavans3

Gallotannins $ Simple phenolic acids1

Shikimic acids and derivatives $ Simple phenolic acids1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3R,4R,5R,6S)-2-[[2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-4H-chromen-3-yl]oxy]-6-methyl-tetrahydropyran-3,4,5-triol	present	NPASS
(2S,3R,4R,5R,6S)-2-[[5,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)-4H-chromen-3-yl]oxy]-6-methyloxane-3,4,5-triol	present	NPASS
[(2R)-2-[3,5-dihydroxy-4-(3,4,5-trihydroxybenzoyl)oxyphenyl]-5-hydroxy-3,4-dihydro-2H-chromen-7-yl] 3,4,5-trihydroxybenzoate	present	NPASS
[(2R)-5-hydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-7-yl] 3,4,5-trihydroxybenzoate	present	NPASS
[(2S)-5-hydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-7-yl] 3,4,5-trihydroxybenzoate	present	NPASS
Epigallocatechin 7-O-gallate	present	NPASS
Epigallocatechin Impurity 2	present	NPASS
Ethyl gallate	present	NPASS
Gallic acid	present	NPASS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Celtis timorensis has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes4

GenBank sequences8

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR199604.1 ↗298 bpChina

ACGT

ATTTGGGCGGGCAGAAATTGGCCTTCCGTGCGCAATGAGCCTCGCGGTTGGCCCAAAAACGAGTCCTTGGTTGCGAGCGCCGCAACCTTC …

Celtis timorensis voucher NG141 internal transcribed spacer 2 and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL4★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Celtis timorensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Mehra, .P.N. & Hans, A.S. 1969, 1972 ; Mehra, P.N. & Gill, B.S. 1974; Sarkar, A.K., Datta, N. et al. 1976

n 102×CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74

CCDB · book-ipcn67-71 — MEHRA, P.N., & A.S. HANS. 1969. In IOPB chromosome number reports XXI. Taxon 18: 310-315.

CCDB · book-ipcn73-74 — MEHRA, P.N., & A.S. HANS. 1972. Comparison of diploid and natural polyploid hardwoods. J. Indian Bot. soc. 51: 319-325.

n 201×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Chatha, G. S. & S. S. Bir. 1987. Population analysis of some woody species from Palni Hills, south India. J. Cytol. Genet. 22: 83–94.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type371 records

Wild obs. + sensor69

Museum / vouchered294

Other8

Origin

Native2

Range

Area of Occupancy AOO692 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 31≤1 km 10≤10 km 7>10 km 7

55 georeferenced · 14 without coordinates

Open the mapobservation + sensor69

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 18≤1 km 10≤10 km 13>10 km 2

43 georeferenced · 251 without coordinates

Open the institutions mapphysical evidence294

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	76
Guilin, CN	50
Kunming, CN	46
Smithfield, AU	25
Brisbane, AU	15
Kew, GB	8
Canberra, AU	7
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	6
Saint Louis, US	5
Nanjing, CN	3
Yangling, CN	3
Mount Annan, AU	2
Pondicherry, IN	2
Berlin, DE	1
Museo Entomologico de Leonlocation not on record	1
Central China Normal Universitylocation not on record	1
Seoul, KR	1
Kensington, AU	1
Wuhan, CN	1
Herbarium of South China Botanical Gardenlocation not on record	1
Edinburgh, GB	1
ASUlocation not on record	1
Adelaide, AU	1
Palmerston, AU	1

24 institutions · 259 of 294 vouchered records shown · 35 without an institution code

09Environmental DNA4 detections

Where the DNA of Celtis timorensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)