Celtis tetrandra

Roxb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Cannabaceae/Celtis

At a glance

Occurrence records1 478

Data sources7

Biological traits25

DNA specimens4

eDNA detections29

Sources7 archives

Databases and archives Celtis tetrandra's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 478 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF1 478 records

Environmental DNA2 datasets · 1 countries29 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

石朴（学名：）为大麻科朴属下的一个种。其种加词“formosana”意为“台湾的”。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology7

Plant height15 m

Seed mass63.29 mg

Seed mass max63.29 mg

Seed mass min63.29 mg

Seed volume86 mm³

Seed volume max94 mm³

Seed volume min78 mm³

Life cycle & reproduction4

Deciduousnessdeciduous

Dispersal typeanimal

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical or tropical

Climberself-supporting

Elevation max3 000 m

Elevation mean1 100 m

Elevation min700 m

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density529 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Celtis tetrandra has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences10

eDNA detections29

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR479837.1 ↗294 bpThailand · 2004

ACGT

GAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACACATCGTTGCCCCCCCCGCGCCTCGCTCTCTGCG …

Celtis tetrandra voucher BBH1957 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL7★ITS3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type1 478 records

Wild obs. + sensor1 093

Museum / vouchered379

Other6

Range

Area of Occupancy AOO2 544 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 621≤1 km 96≤10 km 30>10 km 9

756 georeferenced · 337 without coordinates

Open the mapobservation + sensor1 093

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 2≤10 km 3>10 km 1

6 georeferenced · 373 without coordinates

Open the institutions mapphysical evidence379

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kunming, CN	95
Beijing, CN	58
Anhui Normal Universitylocation not on record	15
Pondicherry, IN	15
Guilin, CN	15
Guangzhou, CN	12
Chengdu, CN	10
Lanzhou, CN	9
Kew, GB	7
South Kensington, GB	4
Wuhan, CN	4
GMBAlocation not on record	3
Southwest Forestry Collegelocation not on record	3
Edinburgh, GB	3
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	2
Awka, NG	2
Seoul, KR	2
Siouxland Heritage Museumlocation not on record	2
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	2
Nanjing, CN	2
Xining, CN	2
Yangling, CN	1
Dresden, DE	1
Auckland, NZ	1
Rotorua, NZ	1
Tianjin Natural History Museumlocation not on record	1
Shenzhen, CN	1
Natural History Museum, Tribhuvan Universitylocation not on record	1
València, ES	1
Saint Louis, US	1

30 institutions · 276 of 379 vouchered records shown · 103 without an institution code

09Environmental DNA29 detections

Where the DNA of Celtis tetrandra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 16.9–16.9

Seasonal swing summer↔winter21.0 °C

Max temp (day)18.8 °C

Min temp (night)14.9 °C

Precipitation84.4 mm/mo

Air humidity62.1 %

Moisture balance-10.4 mm/mo

Vapour deficit730 Pa

Wind speed2.70 m/s

Cloud cover37.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Celtis tetrandra

At a glance

Sources7 archives

Size & morphology7

Life cycle & reproduction4

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

At a glance

Record type1 478 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions22 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 478 records