Celtis paniculata

(Endl.) Planch. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Cannabaceae/Celtis

At a glance

Occurrence records1 329

Data sources8

Biological traits36

DNA specimens9

eDNA detections4

Sources8 archives

Databases and archives Celtis paniculata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 329 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources36 traits

Occurrence & distributionGBIF1 329 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Celtis paniculata, commonly known as tripewood, silky keltis, silky celtis, native hackberry, native celtis, Investigator tree or whitewood, is a rainforest tree native to parts of Malesia, Melanesia and Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology14

Fruit length9.5 mm

Fruit width9 mm

Leaf length50 mm

Leaf length max100 mm

Leaf length min50 mm

Leaf mass per area83.11 g/m2

Leaf size2 436 mm²

Leaf width27.5 mm

Leaf width max45 mm

Leaf width min20 mm

Petiole length0.6 cm

Plant height16 m

Seed length8 mm

Seed width7.5 mm

Life cycle & reproduction6

Deciduousnessevergreen

Flowering timeynnnnnnnnyyy

Life formtree

Life spanperennial

Resprouting capacityresprouts

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Habitat GIFTrain forest, dry forest

Leaf compoundnesssimple

Leaf shapeelliptical lanceolate ovate

Woodinesswoody

Physiology & chemistry3

Photosynthetic pathwayC3

Specific leaf area (SLA)12.13 mm²/mg

Wood density554 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Celtis paniculata has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes4

GenBank sequences3

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF496386.1 ↗552 bpAustralia · 2013

ACGT

AGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTACACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCA …

Celtis paniculata isolate BATT898-10 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type1 329 records

Wild obs. + sensor377

Museum / vouchered612

Cultivated / captive1

Other339

Origin

Native46

Range

Area of Occupancy AOO2 896 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 263≤1 km 27≤10 km 15>10 km 7

312 georeferenced · 65 without coordinates

Open the mapobservation + sensor377

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 113≤1 km 50≤10 km 184>10 km 38

385 georeferenced · 227 without coordinates

Open the institutions mapphysical evidence612

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	179
Smithfield, AU	98
Université de Strasbourglocation not on record	49
Mount Annan, AU	43
Museo Entomologico de Leonlocation not on record	38
Canberra, AU	36
Palmerston, AU	28
Paris, FR	20
Armidale, AU	13
Kew, GB	8
Auckland, NZ	8
James Cook Townsvillelocation not on record	7
Honolulu, US	6
Adelaide, AU	6
Saint Louis, US	6
Wollongong, AU	4
Bronx, US	4
Australian Tropical Herbariumlocation not on record	2
Llocation not on record	2
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Cibinong, ID	1
Monastir, TN	1
University of Stellenboschlocation not on record	1
ASUlocation not on record	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1

25 institutions · 563 of 612 vouchered records shown · 48 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Celtis paniculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.3 °C 20.0–23.5

Seasonal swing summer↔winter10.8 °C

Max temp (day)25.2 °C 24.4–27.5

Min temp (night)16.2 °C 15.2–21.2

Precipitation94.6 mm/mo 31.6–147

Air humidity59.5 % 48.0–61.7

Moisture balance-12.3 mm/mo

Vapour deficit1,074 Pa 941–1,479

Wind speed3.20 m/s

Cloud cover24.8 % 19.9–38.4

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Celtis paniculata

At a glance

Sources8 archives

Size & morphology14

Life cycle & reproduction6

Diet & foraging1

Habitat & environment11

Physiology & chemistry3

Other traits1

At a glance

Record type1 329 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions16 of 25 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 329 records