Celtis koraiensis

Nakai · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Cannabaceae/Celtis

At a glance

Occurrence records451

Data sources11

Biological traits15

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Celtis koraiensis's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility451 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF451 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Celtis koraiensis, commonly known as the Korean hackberry is a deciduous tree in the genus Celtis. The species is endemic to the Korean Peninsula and the north of China. It is typically found in altitudes of 100 to. The tree flowers from April to May, and the fruit ripens from September to October. It can grow up to 15 m in height.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height14.25 m

Life cycle & reproduction3

Deciduousnessdeciduous

Life formtree

Life spanperennial

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max1 500 m

Elevation mean800 m

Elevation min100 m

Growth formtree

Woodinesswoody

Physiology & chemistry3

Leaf n44.7 mg/g

Leaf p2.26 mg/g

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Celtis koraiensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN381780.1 ↗626 bp

ACGT

TTGTCGAAACCTGCACAGCAGAACGACCCGCGAACACGTTTAAAACCAACCGGGGGAGGCCAGGGGACCTCGTGCCTCGGACCTCCCTCG …

Celtis koraiensis isolate Yi 10075 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL6★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Celtis koraiensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Oginuma, K., P. H. Raven & H. Tobe. 1990. Karyomorphology and relationships of Celtidaceae and Ulmaceae (Urticales). Bot. Mag. (Tokyo) 103: 113–131.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type451 records

Wild obs. + sensor136

Museum / vouchered314

Cultivated / captive1

Range

Area of Occupancy AOO892 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 27≤1 km 6>10 km 1

34 georeferenced · 102 without coordinates

Open the mapobservation + sensor136

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤1 km 4≤10 km 5>10 km 1

10 georeferenced · 304 without coordinates

Open the institutions mapphysical evidence314

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	110
Yangling, CN	50
Zhengzhou, CN	22
Lanzhou, CN	10
Herbarium of the Department of Botany, University of Tokyolocation not on record	10
Nanjing, CN	9
Northeastern Forestry Universitylocation not on record	9
KR	8
Kunming, CN	8
Xining, CN	6
Beijing Normal Universitylocation not on record	5
“Manash Kozybayev North Kazakhstan University" NPLClocation not on record	5
Guangzhou, CN	4
Guilin, CN	4
Wuhan, CN	3
SXTCMlocation not on record	3
Kyoto Universitylocation not on record	3
Xian, CN	3
Tianjin Natural History Museumlocation not on record	3
ifplocation not on record	3
Museum of the Rockieslocation not on record	3
Shanghai, CN	3
National Institute of Biological Resourceslocation not on record	3
Peking Universitylocation not on record	2
Xian, CN	2
Korea National Arboretumlocation not on record	2
Chinese Academy of Forestrylocation not on record	2
Anhui Normal Universitylocation not on record	2
Chengdu, CN	2
Central China Normal Universitylocation not on record	2
Beijing, CN	2
Nanyue Arboretumlocation not on record	1
Xinxiang, CN	1
WNNUlocation not on record	1
Philadelphia, US	1
Toyota city nature sanctuarylocation not on record	1
College Park, US	1
Chengdu, CN	1
LDlocation not on record	1
BAYLUlocation not on record	1

40 institutions · 312 of 314 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Celtis koraiensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)