Celtis jessoensis

Koidz. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Cannabaceae/Celtis

At a glance

Occurrence records802

Data sources9

Biological traits8

DNA specimens24

eDNA detections9

Sources9 archives

Databases and archives Celtis jessoensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility802 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF802 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD · NCBI24 specimens

01Narrative

New growth Celtis jessoensis, known as the Japanese hackberry or Jesso hackberry (from an archaic reading of "Ezo": Hokkaidō) is a species of hackberry native to Japan and Korea. It is a deciduous tree growing to 20–25 m tall. The leaves are 5–9 cm long and 3–4 cm broad, with a sharply serrated margin, glaucous beneath and downy on the leaf veins.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Deciduousnessdeciduous

Life formtree

Life spanperennial

Habitat & environment3

Climatetemperate

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Celtis jessoensis has left across the world's sequence archives.

At a glance

DNA specimens24

Marker genes3

GenBank sequences10

eDNA detections9

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLLC693413.1 ↗573 bpJapan · 2011

ACGT

AAGATTATAAATTGACTTATTACACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTTAGAGTAACTCCTCAACCTGGAG …

Celtis jessoensis TF<JPN>:TSM_77 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL8trnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type802 records

Wild obs. + sensor186

Museum / vouchered607

Cultivated / captive9

Range

Area of Occupancy AOO2 188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy24% within 1 km

≤100 m 3≤1 km 2≤10 km 7>10 km 9

21 georeferenced · 165 without coordinates

Open the mapobservation + sensor186

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤1 km 41≤10 km 85>10 km 2

128 georeferenced · 479 without coordinates

Open the institutions mapphysical evidence607

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 5

5 georeferenced · 4 without coordinates

Open the mapnot free-living9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Nagano City, JP	89
Odawara, JP	61
KR	55
Shinshu Universitylocation not on record	41
Sanda, JP	40
KURAlocation not on record	34
Toyama, JP	33
Tomioka, JP	30
FFPRIlocation not on record	27
JP	21
Tsukuba, JP	19
Herbarium of the Department of Botany, University of Tokyolocation not on record	18
Nagatoro-machi, Chichibu-gun, JP	11
Kyoto Universitylocation not on record	10
Iwate Prefectural Museumlocation not on record	10
Tokushima, JP	9
Forestry and Forest Products Research Institutelocation not on record	9
Sagamihara, JP	9
Bando, JP	8
Kochi, JP	8
Cambridge, US	5
Sendai, JP	5
Akita Prefectural Museumlocation not on record	4
Elocation not on record	3
Gifu prefectural Museumlocation not on record	3
Nishihara, JP	3
Omachi Alpine Museumlocation not on record	3
National Institute of Biological Resourceslocation not on record	2
Museum of the Rockieslocation not on record	2
Nishihara, JP	2
KOMlocation not on record	1
Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record	1
KIWElocation not on record	1
DMZ botanic gardenlocation not on record	1
Vancouver, CA	1
Beijing, CN	1
Chiba, JP	1
SJNAlocation not on record	1
Otaru, JP	1
Fukushima Universitylocation not on record	1

40 institutions · 584 of 607 vouchered records shown · 23 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA9 detections

Where the DNA of Celtis jessoensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.4 °C 13.8–22.3

Seasonal swing summer↔winter21.6 °C

Max temp (day)23.1 °C 15.8–25.0

Min temp (night)16.2 °C 9.90–18.5

Precipitation237 mm/mo 163–606

Air humidity65.6 % 59.3–68.8

Moisture balance167 mm/mo

Vapour deficit744 Pa 547–991

Wind speed2.70 m/s

Cloud cover41.5 % 32.1–44.4

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)