Celtis gomphophylla

Baker · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Cannabaceae/Celtis

At a glance

Occurrence records405

Data sources8

Biological traits38

DNA specimens4

eDNA detections2

Sources8 archives

Databases and archives Celtis gomphophylla's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility405 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources38 traits

Occurrence & distributionGBIF405 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

تريمة متكاملة الأوراق هي نوع غير مؤكد من النباتات يتبع جنس التريمة من الفصيلة القنبية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology13

Fruit length9 mm

Fruit width6 mm

Leaf length94 mm

Leaf width38 mm

Plant height20 m

⚠ sources differ — GIFT: 20 m · TRY: 9.7 m

Plant height max30 m

Plant height min3 m

Seed length5 mm

Seed mass14.96 mg

Seed volume36 mm³

Seed volume max36 mm³

Seed volume min36 mm³

Seed width max3.1 mm

Life cycle & reproduction6

Deciduousnessdeciduous

Dehiscenceindehiscent

Dispersal typeanimal

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climberself-supporting

Elevation max800 m

Elevation min2 m

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Habitat GIFTrainforest (above 300 m)

Woodinesswoody

Physiology & chemistry6

Leaf dry-matter content (LDMC)420 mg/g

Leaf n29.9 mg/g

Leaf p1.51 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density521 mg/cm³

Other traits2

Leaf thickness0.021 mm

Seed height max3.1 mm

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Celtis gomphophylla has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences2

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLJX572396.1 ↗552 bpSouth Africa · 2010

ACGT

AGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTACACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCA …

Celtis gomphophylla voucher Abbott9159 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa

plant barcode

08Occurrence & distribution

Record type405 records

Wild obs. + sensor20

Museum / vouchered385

Range

Area of Occupancy AOO700 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 4≤1 km 10≤10 km 1>10 km 4

19 georeferenced · 1 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 383 without coordinates

Open the institutions mapphysical evidence385

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	52
MeiseBGlocation not on record	31
Durban, ZA	30
Pretoria, ZA	29
Kew, GB	27
Plocation not on record	21
Yaoundé, CM	19
BRLUlocation not on record	13
WAGlocation not on record	12
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	11
National Herbarium of São Tomé and Principelocation not on record	10
TAFORI-LSRClocation not on record	9
National Museums of Kenyalocation not on record	9
Instituto de Investigação Científica Tropicallocation not on record	8
Paris, FR	5
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	4
Dresden, DE	4
Uppsala, SE	4
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	4
University of Stellenboschlocation not on record	4
Glocation not on record	3
Bronx, US	3
IPHAMETRAlocation not on record	2
LBVlocation not on record	2
Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record	2
Arusha, TZ	2
CJBGlocation not on record	1
Haramaya Universitylocation not on record	1
Limbe Botanical & Zoological Gardenslocation not on record	1
University of Comoroslocation not on record	1
Coimbra, PT	1
Clocation not on record	1
University of Johannesburglocation not on record	1
Daubeny Herbarium, Oxfordlocation not on record	1
Herbier National du Gabonlocation not on record	1
Addis Ababa, ET	1
Istituto Agrario Castelnuovolocation not on record	1
South Kensington, GB	1
MAlocation not on record	1
St. Paul, US	1

40 institutions · 334 of 385 vouchered records shown · 51 without an institution code

09Environmental DNA2 detections

Where the DNA of Celtis gomphophylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.1 °C 20.1–26.1

Seasonal swing summer↔winter7.50 °C

Max temp (day)29.1 °C 25.2–32.9

Min temp (night)17.4 °C 15.1–19.6

Precipitation52.6 mm/mo 12.2–92.9

Air humidity51.9 % 39.8–63.9

Moisture balance-89.1 mm/mo -154–-24.3

Vapour deficit1,486 Pa 890–2,083

Wind speed2.70 m/s 1.80–3.50

Cloud cover20.8 % 13.6–28.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)