Cellypha goldbachii

(Weinm.) Donk · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Tricholomataceae/Cellypha

At a glance

Occurrence records300

Data sources9

Biological traits0

DNA specimens1

eDNA detections21

Sources9 archives

Databases and archives Cellypha goldbachii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility300 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF300 records

Environmental DNA5 datasets · 5 countries21 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Cellypha goldbachii is a species of fungi in the family Tricholomataceae, and the type species of the genus Cellypha.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cellypha goldbachii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences4

eDNA detections21

Countries5

The DNA barcodea real sequence read deposited for this species

ITSOR807118.1 ↗554 bpPoland · 2023

ACGT

TTATTGAATGTTTGAAGTTTGTTGAGGGCATACTGGTTCTTAATGGACATGTGCTCGCTGTCTTCTATTCATCTTATCCACCTGTGCACT …

Cellypha goldbachii voucher WA0000165031 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

08Occurrence & distribution

Record type300 records

Wild obs. + sensor196

Museum / vouchered103

Cultivated / captive1

Range

Area of Occupancy AOO896 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 71≤1 km 29≤10 km 79>10 km 1

180 georeferenced · 16 without coordinates

Open the mapobservation + sensor196

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 17≤1 km 14≤10 km 12

43 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence103

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Copenhagen, DK	15
Kew, GB	7
BDBClocation not on record	6
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	4
Auckland, NZ	4
GJOlocation not on record	3
WU-MYClocation not on record	3
Tartu, EE	2
Olocation not on record	2
Tilburg, NL	2
SLU Artdatabankenlocation not on record	2
Toronto, CA	2
Chicago, US	1
Oulu, FI	1
Gijón, ES	1
University of Oslo, Natural History Museumlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
Karlsruhe, DE	1
Canberra, AU	1
University of Warsawlocation not on record	1

20 institutions · 60 of 103 vouchered records shown · 43 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA21 detections

Where the DNA of Cellypha goldbachii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys5

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH6.40 6.30–6.60

Conductivity69.0 µS/cm 33.0–74.0

Organic carbon1.25 % 0.82–3.59

Nitrate-N7.00 mg/kg 2.00–13.0

Phosphorus14.0 mg/kg 4.00–119

Clay27.1 % 25.3–28.8

Sand59.0 % 58.8–59.2

Depth0 m 0–0.2

SoilSodosolKandosol

3 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 15.6–23.6

Seasonal swing summer↔winter21.4 °C

Max temp (day)20.2 °C 18.7–29.4

Min temp (night)12.5 °C 11.2–18.2

Precipitation81.2 mm/mo 42.7–87.9

Air humidity60.2 % 51.5–61.5

Moisture balance-25.6 mm/mo -128–-5.90

Vapour deficit761 Pa 698–1,431

Wind speed3.10 m/s 2.00–4.00

Cloud cover37.8 % 25.6–43.9

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)