Ceanothus otayensis

Mc Minn · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Ceanothus

At a glance

Occurrence records187

Data sources5

Biological traits2

DNA specimens4

eDNA detections2

Sources5 archives

Databases and archives Ceanothus otayensis's data was compiled from.

GBIFGlobal Biodiversity Information Facility187 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF187 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

02Traits & measurements

SourcesWCVP

Life cycle & reproduction1

Life formshrub

Habitat & environment1

Climatetemperate

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ceanothus otayensis has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences1

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSHQ325374.1 ↗614 bpMexico

ACGT

TCGATACCTGCCTAGCAGAACGACCCGTGAACCCGTAAAAACATACCGGGGGGCCCGGGGCCTCCACGCCTCGGACCCTCTTGGTCGGGA …

Ceanothus otayensis internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type187 records

Wild obs. + sensor174

Museum / vouchered13

Range

Area of Occupancy AOO132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 89≤1 km 3≤10 km 7>10 km 2

101 georeferenced · 73 without coordinates

Open the mapobservation + sensor174

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 10

10 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	4
San Diego, US	4
Ensenada, MX	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Calabar, NG	1
Austin, US	1

6 institutions · 12 of 13 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Ceanothus otayensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.0 °C 15.8–16.2

Seasonal swing summer↔winter9.10 °C

Max temp (day)21.0 °C 20.2–21.8

Min temp (night)11.0 °C 9.40–12.6

Precipitation19.5 mm/mo 7.40–31.6

Air humidity56.1 % 52.0–60.3

Moisture balance-112 mm/mo -126–-96.9

Vapour deficit800 Pa 732–867

Wind speed2.70 m/s 1.70–3.80

Cloud cover24.5 % 23.7–25.3

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)