Ceanothus megacarpus

Nutt. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Ceanothus

At a glance

Occurrence records1 137

Data sources8

Biological traits101

DNA specimens6

eDNA detections5

Sources8 archives

Databases and archives Ceanothus megacarpus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 137 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources101 traits

Occurrence & distributionGBIF1 137 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Ceanothus megacarpus là một loài thực vật có hoa trong họ Táo. Loài này được Nutt. mô tả khoa học đầu tiên năm 1846.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology4

Plant height4 m

Seed mass24.48 mg

⚠ sources differ — TRY: 24.48 mg · GIFT: 27.12 mg

Seed mass max24.01 mg

Seed mass min24 mg

Life cycle & reproduction25

Bloom periodLate Winter

Coppice potentialYes

Deciduousnessevergreen

Dispersal typeunspecialized

Flower colourwhite

Flower conspicuousYes

Fruit seed period beginSpring

Fruit seed period endFall

Growth rate USDAModerate

Life formshrub

Life spanperennial

Lifespan categoryModerate

Propagated by bare rootYes

Propagated by bulbNo

Propagated by containerYes

Propagated by cormNo

Propagated by cuttingsYes

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityYes

Seed spread rateModerate

Seedling vigorMedium

Vegetative spread rateNone

Diet & foraging1

Parasiteindependent

Habitat & environment25

Active growth periodSummer and Fall

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerModerate

Foliage porosity winterPorous

Foliage textureFine

Fruit colourbrown

Growth formshrub

Growth form USDAMultiple Stem

Hedge toleranceHigh

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Mycorrhiza typenon-ectomycorrhizal

Root depth min12 in

Shape and orientationErect

Small grainNo

Woodinesswoody

Physiology & chemistry24

Anaerobic toleranceNone

C:N ratioHigh

Caco3 toleranceHigh

Cold stratification requiredYes

Drought toleranceHigh

Fertility requirementLow

Fire resistantNo

Fire toleranceMedium

Frost free days min250 days

Leaf n18.69 mg/g

Leaf p0.883 mg/g

Moisture useLow

Nitrogen fixation levelLow

Photosynthetic pathwayC3

Precipitation max24 in

Precipitation min9 in

Protein potentialMedium

Salinity toleranceNone

Shade toleranceHigh

Soil pH max8 pH

Soil pH min7 pH

Specific leaf area (SLA)4.72 mm²/mg

Temperature min24 °F

Wood density667 mg/cm³

Uses & economy15

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityNo Known Source

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productYes

Palatable browse animalLow

Palatable graze animalLow

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound15 000 per lb

ToxicityNone

Veneer productNo

Other traits7

Fall conspicuousNo

Fruit seed abundanceHigh

Fruit seed conspicuousNo

Fruit seed persistenceNo

Height at 20yr2.74 m

Planting density max700 per acre

Planting density min300 per acre

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ceanothus megacarpus has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences5

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF048957.1 ↗602 bp

ACGT

TCGATACCTGCCTAGCAGAACGACCCGTGAACCCGTAAAAACATACCGGGGGGCCCGGGGCCTCCCGCCTCGGACCCTCTTGGTCGGGAG …

Ceanothus megacarpus var. megacarpus isolate 871618mega internal transcribed spacer 1, 5.8S ribosomal RNA, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcLa★ITS4★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type1 137 records

Wild obs. + sensor896

Museum / vouchered241

Origin

Native62

Range

Area of Occupancy AOO1 416 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 526≤1 km 63≤10 km 21>10 km 45

655 georeferenced · 241 without coordinates

Open the mapobservation + sensor896

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 12≤1 km 82≤10 km 67>10 km 3

164 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence241

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	64
Los Angeles, US	40
Riverside, US	20
Santa Barbara, US	17
Irvine, US	15
San Diego, US	13
US	8
San Luis Obispo, US	8
Davis, US	7
Northridge, US	6
Fullerton, US	5
San Jose, US	4
CASlocation not on record	3
Christchurch, NZ	3
Long Beach, US	3
South Kensington, GB	2
Catalina Island Conservancylocation not on record	2
Wuzhou, CN	2
Flagstaff, US	2
Canadian Department of Agriculturelocation not on record	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
Durham, US	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
Arcata, US	1
San Francisco, US	1
Bloomington, US	1
Severin-McDaniel Insect Collectionlocation not on record	1
EL PASO, US	1
Angwin, US	1

29 institutions · 236 of 241 vouchered records shown · 5 without an institution code

09Environmental DNA5 detections

Where the DNA of Ceanothus megacarpus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

Chaparral on NW slopes.|Valley bottom, east-…Chaparral on NW slopes.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.9 °C 13.9–13.9

Seasonal swing summer↔winter9.50 °C

Max temp (day)18.2 °C

Min temp (night)9.20 °C

Precipitation57.3 mm/mo

Air humidity61.1 %

Moisture balance-41.3 mm/mo

Vapour deficit616 Pa

Wind speed1.60 m/s

Cloud cover30.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ceanothus megacarpus

At a glance

Sources8 archives

Size & morphology4

Life cycle & reproduction25

Diet & foraging1

Habitat & environment25

Physiology & chemistry24

Uses & economy15

Other traits7

At a glance

Record type1 137 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions23 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 137 records