Ceanothus fresnensis

Dudley ex Abrams · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Ceanothus

At a glance

Occurrence records110

Data sources7

Biological traits89

DNA specimens3

eDNA detections3

Sources7 archives

Databases and archives Ceanothus fresnensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility110 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources89 traits

Occurrence & distributionGBIF110 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Ceanothus fresnensis is a species of shrub in the family Rhamnaceae known by the common name Fresno mat. It is endemic to California, where it grows in central sections of the Sierra Nevada and its foothills. Its habitat includes dry woodland and coniferous forest.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology1

Plant height0.3 m

Life cycle & reproduction23

Bloom periodLate Spring

Coppice potentialNo

Flower colourblue

Flower conspicuousYes

Fruit seed period beginSpring

Fruit seed period endSummer

Growth rate USDASlow

Life formsubshrub

Life spanperennial

Lifespan categoryLong

Propagated by bare rootYes

Propagated by bulbNo

Propagated by containerYes

Propagated by cormNo

Propagated by cuttingsYes

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityYes

Seed spread rateSlow

Seedling vigorLow

Vegetative spread rateModerate

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorGray-Green

Foliage porosity summerDense

Foliage porosity winterModerate

Foliage textureMedium

Fruit colourbrown

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Subshrub, Shrub

Growth form USDASingle Crown

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min18 in

Shape and orientationProstrate

Small grainNo

Woodinesswoody

Physiology & chemistry19

Anaerobic toleranceNone

C:N ratioHigh

Caco3 toleranceLow

Cold stratification requiredYes

Drought toleranceHigh

Fertility requirementLow

Fire resistantNo

Fire toleranceMedium

Frost free days min140 days

Moisture useLow

Nitrogen fixation levelLow

Photosynthetic pathwayC3

Precipitation max60 in

Precipitation min18 in

Salinity toleranceNone

Shade toleranceLow

Soil pH max7 pH

Soil pH min5.8 pH

Temperature min-23 °F

Uses & economy14

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityNo Known Source

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productYes

Palatable browse animalMedium

Palatable graze animalLow

Palatable humanNo

Post productNo

Pulpwood productNo

ToxicityNone

Veneer productNo

Other traits7

Fall conspicuousNo

Fruit seed abundanceLow

Fruit seed conspicuousNo

Fruit seed persistenceNo

Height at 20yr0.305 m

Planting density max4 800 per acre

Planting density min2 700 per acre

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ceanothus fresnensis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF048942.1 ↗603 bp

ACGT

TCGATACCTGCCTAGCAGAACGACCCGTGAACCCGTAAAAACATACCGGGGGGCCCGGGGCCTCCACGCCTCGGACCCTCTTGGTCGGGA …

Ceanothus fresnensis isolate 30096fresn internal transcribed spacer 1, 5.8S ribosomal RNA, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type110 records

Wild obs. + sensor34

Museum / vouchered75

Fossil1

Range

Area of Occupancy AOO272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 21>10 km 4

25 georeferenced · 9 without coordinates

Open the mapobservation + sensor34

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 4≤1 km 26≤10 km 27>10 km 1

58 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence75

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Davis, US	10
Santa Barbara, US	6
Claremont, US	5
CASlocation not on record	4
Riverside, US	3
Fullerton, US	3
San Jose, US	2
San Luis Obispo, US	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Angwin, US	1

10 institutions · 37 of 75 vouchered records shown · 38 without an institution code

09Environmental DNA3 detections

Where the DNA of Ceanothus fresnensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)