Cayratia pedata

(Lam.) Gagnep. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Vitales/Vitaceae/Cayratia

At a glance

Occurrence records91

Data sources10

Biological traits27

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Cayratia pedata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility91 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Occurrence & distributionGBIF91 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 80

01Narrative

鸟足乌蔹莓（学名：）为葡萄科乌蔹莓属下的一个种。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology12

Fruit length13.5 mm

Fruit length max15 mm

Fruit length min12 mm

Fruit width13.5 mm

Fruit width max15 mm

Fruit width min12 mm

Leaf length135 mm

Leaf length max220 mm

Leaf length min50 mm

Leaf width57.5 mm

Leaf width max90 mm

Leaf width min25 mm

Life cycle & reproduction4

Deciduousnessevergreen

Life formliana

Life spanperennial

Sex typehermaphrodite

Habitat & environment9

Climatewet tropical

Climberobligatory

Elevation max2 200 m

Elevation mean1 500 m

Elevation min800 m

Fruit fleshinessfleshy

Fruit typeberry

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: climber_herbaceous · TRY: climber

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous semi_woody · GIFT: woody

Physiology & chemistry2

Leaf dry-matter content (LDMC)432 mg/g

Specific leaf area (SLA)10.62 mm²/mg

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cayratia pedata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences6

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKT344590.1 ↗673 bp

ACGT

TCGACCGAACGACCTGTGAACACGTTGTTTAACCACCCTATGAGGGCGAAGCACTTCGCCTTCGAAGGATCGGGAGGGCCTTGGGAGCCT …

Cayratia pedata voucher Wen 7428 (US) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cayratia pedata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 80 n = 40

Ploidypolyploid inferred

Chromosome records40–802n range62median80mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 803×CCDB · book-ipcn67-71 · CCDB · book-indian_vol1 · CCDB · book-fedorov

CCDB · book-ipcn67-71 — HAZRA, R., & A. SHARMA. 1970. Chromosomes of some Indian Vitaceae. Folia Biol. (Cracow). 18: 123-136.

CCDB · book-indian_vol1 — Vatsala, P. 1960 ; Hazra, R. & Sharma, A. 1970

CCDB · book-fedorov — Vatsala 1960

2n 442×CCDB · ipcn-api-dl · CCDB · book-indian_vol1

CCDB · ipcn-api-dl — Patil, V. P., M. S. Kumbhojkar & A. S. Jadhav. 1980. Chromosome numbers in the family Vitaceae. Curr. Sci. 49: 37–38.

CCDB · book-indian_vol1 — Patil, V.P. et al. 1980

2n 401×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Patil, V.P. et al. 1980

n 202×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Sarkar, A. K., N. DATTA & U. Chatterjee. 1972. Chromosome survey of certain angiosperms. I. Bull. Bot. Surv. India 14: 170.

CCDB · ipcn-api-dl — Patil, V. P., M. S. Kumbhojkar & A. S. Jadhav. 1980. Chromosome numbers in the family Vitaceae. Curr. Sci. 49: 37–38.

n 402×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Sarkar, A. K., N. DATTA & U. Chatterjee. 1972. Chromosome survey of certain angiosperms---I. Bull. Bot. Surv. India 14: 170.

CCDB · book-ipcn75-78 — Sarkar et al. 1972

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type91 records

Wild obs. + sensor40

Museum / vouchered50

Other1

Range

Area of Occupancy AOO216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤1 km 21>10 km 14

35 georeferenced · 5 without coordinates

Open the mapobservation + sensor40

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 2≤1 km 6≤10 km 1>10 km 1

10 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence50

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kunming, CN	19
Kew, GB	5
University of Stellenboschlocation not on record	5
Canberra, AU	5
Yangling, CN	4
James Cook Townsvillelocation not on record	2
Stockholm, SE	1
Beijing, CN	1
Paris, FR	1
Guilin, CN	1
Kensington, AU	1
Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record	1
South Kensington, GB	1
Adelaide, AU	1
La Trobe Universitylocation not on record	1
Edinburgh, GB	1

16 institutions · 50 of 50 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Cayratia pedata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)