Cavendishia grandifolia

Herold · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ericales/Ericaceae/Cavendishia

At a glance

Occurrence records39

Data sources8

Biological traits12

DNA specimens5

eDNA detections4

Sources8 archives

Databases and archives Cavendishia grandifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility39 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF39 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Cavendishia grandifolia là một loài thực vật có hoa trong họ Thạch nam. Loài này được Herold mô tả khoa học đầu tiên năm 1909.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max3 m

Life cycle & reproduction2

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 975 m

Elevation min1 250 m

Epiphyteobligatory

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Epiphyte

Woodinesswoody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cavendishia grandifolia has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences4

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOL536405.1 ↗352 bpUSA · 2019

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCATTAGGTTGAAGGCACGTCTGCCTGGGCGTCACGCATT …

Cavendishia grandifolia voucher MO:Carlsen3569 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS3★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type39 records

Wild obs. + sensor28

Museum / vouchered11

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 28

28 georeferenced

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 11 records without

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Davis, US	5
Austin, US	2
Quito, EC	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

4 institutions · 10 of 11 vouchered records shown · 1 without an institution code

09Environmental DNA4 detections

Where the DNA of Cavendishia grandifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.8 °C 25.8–25.8

Seasonal swing summer↔winter26.3 °C

Max temp (day)31.0 °C

Min temp (night)21.4 °C

Precipitation118 mm/mo

Air humidity57.3 %

Moisture balance-66.1 mm/mo

Vapour deficit1,414 Pa

Wind speed2.70 m/s

Cloud cover30.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)