Cavanillesia chicamochae

Fern.Alonso · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Cavanillesia

At a glance

Occurrence records33

Data sources8

Biological traits11

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Cavanillesia chicamochae's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility33 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Occurrence & distributionGBIF33 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Cavanillesia hylogeiton, also known as Ceiba Barrigona, is a species of trees in the family Malvaceae. It is native to Colombia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 100 m

Elevation min230 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cavanillesia chicamochae has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKM245253.1 ↗624 bpColombia

ACGT

CCCCCTCGGCGCCCGTGCGTGCGGGACCGGGCCTCGCCGCGCCCCCCGGGCGGGCGTGATGCCCGGTCGCGTCGCTCGCGGCCGAACAAC …

Cavanillesia chicamochae voucher D. Castellanos 47 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type33 records

Wild obs. + sensor18

Museum / vouchered12

Cultivated / captive3

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 10

10 georeferenced · 8 without coordinates

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤1 km 8≤10 km 2>10 km 1

11 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence12

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Universidad Nacional de Colombia (UNAL)location not on record	9
Universidad de Antioquia (UdeA)location not on record	2
Universidad Industrial de Santander (UIS)location not on record	1

3 institutions · 12 of 12 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Cavanillesia chicamochae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)