Cautleya gracilis

(Sm.) Dandy · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Zingiberaceae/Cautleya

At a glance

Occurrence records246

Data sources11

Biological traits15

DNA specimens4

eDNA detections5

Sources11 archives

Databases and archives Cautleya gracilis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility246 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF246 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Cautleya gracilis is a perennial herbaceous plant in the family Zingiberaceae (the gingers). It is found in the Himalayas through to south China and Vietnam. It is cultivated as an ornamental garden plant, hardy to a few degrees of frost.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass2.21 mg

Seed mass max2.21 mg

Seed mass min2.21 mg

Life cycle & reproduction3

Deciduousnessevergreen

Life formrhizomatous geophyte or epiphyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max3 100 m

Elevation min1 200 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cautleya gracilis has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMF785571.1 ↗349 bpChina · 2007

ACGT

TGCAGAATCTCGTGAACCATTGAGTCTTTGAACGCAAGTTGTGCCCGAGGCCTTGTGGCCGAGGGCACGCCTGCTTGGGCGTCATGACAT …

Cautleya gracilis 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cautleya gracilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n -131×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Mehra, P. N. & S. K. Sachdeva. 1979. Cytological observations on some East-Himalayan monocots. Cytologia 44: 233–240.

n 121×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Sachdeva 1977

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.895 ↗

08Occurrence & distribution

Record type246 records

Wild obs. + sensor23

Museum / vouchered215

Cultivated / captive5

Other3

Range

Area of Occupancy AOO364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 1≤1 km 6≤10 km 2>10 km 2

11 georeferenced · 12 without coordinates

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 212 without coordinates

Open the institutions mapphysical evidence215

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kunming, CN	95
Beijing, CN	62
CASlocation not on record	9
Yunnan Universitylocation not on record	7
Xiamen, CN	6
University of Stellenboschlocation not on record	6
Nanjing, CN	4
Kew, GB	3
Guilin, CN	3
Taipei, TW	3
Edinburgh, GB	2
Chongqing Natural History Museumlocation not on record	2
Vancouver, CA	1
Bronx, US	1
National Institute of Biological Resourceslocation not on record	1
Moscow State Universitylocation not on record	1
US	1
Fort Worth, US	1

18 institutions · 208 of 215 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Cautleya gracilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)