Caulophyllum giganteum

(Farw.) H.Loconte & W.H.Blackw. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Berberidaceae/Caulophyllum

At a glance

Occurrence records5 274

Data sources11

Biological traits9

DNA specimens3

eDNA detections2

Sources11 archives

Databases and archives Caulophyllum giganteum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 274 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF5 274 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Caulophyllum giganteum, the northern blue cohosh, is a species of flowering plant in the barberry family. It is native primarily to northeastern North America, where it is found in rich forests.Flora of North America Caulophyllum giganteum produces around four to eighteen purple flowers in early spring. It blooms around 10–15 days earlier than its relative, Caulophyllum thalictroides. C. thalictroides also differs by having more abundant flowers that are yellow or green.Flora of the Southern and Mid-Atlantic States

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Caulophyllum giganteum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMG248494.1 ↗553 bpCanada · 1966

ACGT

AAGTGTTGGATTCAAAGCGGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGC …

Caulophyllum giganteum voucher CCDB-23957-A01 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★rbcLa★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Caulophyllum giganteum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · eflora

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type5 274 records

Wild obs. + sensor5 014

Museum / vouchered260

Range

Area of Occupancy AOO10 584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 2 787≤1 km 710≤10 km 261>10 km 407

4 165 georeferenced · 849 without coordinates

Open the mapobservation + sensor5 014

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 22≤1 km 49≤10 km 126>10 km 9

206 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence260

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chongqing Museumlocation not on record	117
Philadelphia, US	62
Ann Arbor, US	28
Burlington, US	20
University of New Hampshirelocation not on record	4
Morgantown, US	4
Bronx, US	3
Montréal, CA	3
Toronto, CA	3
Wuzhou, CN	2
Madison, US	2
Beijing, CN	1
Acadia Universitylocation not on record	1
New Brunswick, US	1
University of Stellenboschlocation not on record	1
Richmond, US	1
Elikins, US	1
McWane Science Centerlocation not on record	1

18 institutions · 255 of 260 vouchered records shown · 5 without an institution code

09Environmental DNA2 detections

Where the DNA of Caulophyllum giganteum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Caulophyllum giganteum

At a glance

Sources11 archives

Life cycle & reproduction2

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type5 274 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type5 274 records