Caulerpa chemnitzia

(Esper) J.V.Lamour. · species

image placeholder — illustration coming later

Plantae/Chlorophyta/Ulvophyceae/Bryopsidales/Caulerpaceae/Caulerpa

At a glance

Occurrence records1 412

Data sources7

Biological traits6

DNA specimens10

eDNA detections19

Sources7 archives

Databases and archives Caulerpa chemnitzia's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility768 records↗

OBISOcean Biodiversity Information System644 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS1 412 records

Environmental DNA1 datasets · 6 countries19 detections

DNA & barcodingBOLD · NCBI10 specimens

01Narrative

Caulerpa chemnitzia is a species of seaweed in the Caulerpaceae family. It is found along the coast in a large area extending from north of Perth to the Kimberley region of Western Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonesessile

Uses & economy1

Commercial importancecommercial

Other traits2

Depth max6 m

Depth min3 m

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Caulerpa chemnitzia has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes5

GenBank sequences10

eDNA detections19

Countries6

The DNA barcodea real sequence read deposited for this species

ITSMN413520.1 ↗554 bpThailand

ACGT

TGCCGAAGGAACATTATCCGGCAATCACAACTACACACTCTATCTATGTGTGTGTGTGTGTATGTAAAACACTTAAGACTATGGACTATT …

Caulerpa chemnitzia voucher PSU_KP50A small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS9★ITS1tufAUPA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type1 412 records

Wild obs. + sensor585

Museum / vouchered647

Other180

Origin

Native13

Range

Area of Occupancy AOO2 588 km²

Depth

0–200 m sunlit123

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 10 m · max 275 m · 124 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 48≤1 km 73≤10 km 16>10 km 19

156 georeferenced · 429 without coordinates

Open the mapobservation + sensor585

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 87≤1 km 25≤10 km 96>10 km 5

213 georeferenced · 434 without coordinates

Open the institutions mapphysical evidence647

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	109
University of Stellenboschlocation not on record	38
Salvador, BR	27
Wellington, NZ	24
Hobart, AU	18
MeiseBGlocation not on record	15
Instituto do Meio Ambientelocation not on record	13
Puerto Ayora, EC	13
Chaguaramas, TT	13
UFRPElocation not on record	12
Institut de Recherche pour le Developpement, New Caledonia, Herbarium of the IRD Noumealocation not on record	6
IPA/SPlocation not on record	5
Bronx, US	5
UFBAlocation not on record	3
Museo Entomologico de Leonlocation not on record	3
Herbario de la Facultad de Ciencias (FCME)location not on record	3
Centro de Investigación Científica de Yucatán, A. C., Unidad de Ciencias del Agualocation not on record	2
Naturalis Biodiversity Centerlocation not on record	2
Ann Arbor, US	2
McWane Science Centerlocation not on record	2
Albany, US	1
Mutare Museumlocation not on record	1
JBRJlocation not on record	1
BISHlocation not on record	1
University of Dar es Salaamlocation not on record	1
San Diego, US	1
Minia, EG	1
Honolulu, US	1
South Kensington, GB	1
Fredericksburg, US	1
Departamento de Sistematica e Ecologialocation not on record	1

31 institutions · 326 of 647 vouchered records shown · 184 without an institution code

09Environmental DNA19 detections

Where the DNA of Caulerpa chemnitzia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map6 countries0

Marine

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.4 °C 20.7–26.9

Seasonal swing summer↔winter3.80 °C

Max temp (day)27.4 °C 25.8–30.5

Min temp (night)24.5 °C 14.1–26.1

Precipitation109 mm/mo 27.9–286

Air humidity62.6 % 51.3–63.5

Moisture balance41.9 mm/mo

Vapour deficit1,267 Pa 1,165–1,616

Wind speed5.20 m/s

Cloud cover27.9 % 18.0–37.2

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Caulerpa chemnitzia

At a glance

Sources7 archives

Habitat & environment3

Uses & economy1

Other traits2

At a glance

Record type1 412 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 412 records