Cattleya warscewiczii

Rchb.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Cattleya

At a glance

Occurrence records55

Data sources9

Biological traits11

DNA specimens4

eDNA detections2

Sources9 archives

Databases and archives Cattleya warscewiczii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility55 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF55 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Cattleya warscewiczii (The "Warscewicz's Cattley's orchid"), a labiate Cattleya, is a species of orchid. Drawing of C. warscewiczii in Xenia Orchidacea vol. 1, 1858 It was first collected by Józef Warszewicz in Colombia in 1848-49 and formally described by Heinrich Gustav Reichenbach in 1855.The Showy Cattleya, Queen of the Orchids (Beginners` Handbook - XV) American Orchid Society Bulletin Vol.25, No.2 p.159 (1956) [1] C. warscewiczii exhibits a typical Cattleya sympodial habit. Pseudobulbs are 8-16" (20-40 cm) long, unifoliate, cylindrical or cigar-shaped, grooved. Flowers are 7-11" (17.5-27.5 cm) across, largest in the genus, showy, fragrant.I. F. La Croix. The New Encyclopedia of Orchids: 1500 Species in Cultivation (Timber Press, 2008), p.92 In culture the flowering is in summer on that year's spring growth. Strong light and good air movement are required. The diploid chromosome number of C. warscewiczii has been determined as 2n = 40; the haploid chromosome number as n = 20.page 251 of L. P. Felix and M. Guerra: "Variation in chromosome number and the basic number of subfamily Epidendroideae (Orchidaceae)" Botanical Journal of the Linnean Society 163(2010)234—278. The Linnean Society of London. Downloaded October 2010 from http://onlinelibrary.wiley.com/doi/10.1111/j.1095-8339.2010.01059.x/abstract C. warscewiczii hybridizes naturally with C. aurea / dowiana, producing C. x hardyana. C. warscewiczii has also been used extensively in Cattleya hybridization, to produce large-flowered hybrid Cattleyas.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formpseudobulbous epiphyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 600 m

Elevation min300 m

Epiphyteobligatory

Growth formepiphyte

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cattleya warscewiczii has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY008603.1 ↗632 bp

ACGT

TCGAGACCGAAATATATCGAGCGATTCGGAGAACTCGTGAATGCGCGGCGGCAGCTGGCGTCGCGGAACAGCCGTCCCGATCCCGGCCTC …

Cattleya warscewiczii isolate MWC1262 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLa★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cattleya warscewiczii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidydiploid inferred

Chromosome records40–402n range40median40mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 402×CCDB · book-fedorov · CCDB · Cave1963

CCDB · book-fedorov — Chardard 1963

CCDB · Cave1963 — Chardard 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type55 records

Wild obs. + sensor44

Museum / vouchered10

Cultivated / captive1

Range

Area of Occupancy AOO200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 17≤1 km 11≤10 km 3>10 km 6

37 georeferenced · 7 without coordinates

Open the mapobservation + sensor44

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤1 km 2>10 km 3

5 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence10

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Fundación Jardín Botánico Joaquín Antonio Uribe de Medellín (JBM)location not on record	4
South Kensington, GB	2
Denver, US	1
Tampa, US	1
Universidad del Valle (UniValle)location not on record	1
Jardín Botánico José Celestino Mutis (JBBJCM)location not on record	1

6 institutions · 10 of 10 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Cattleya warscewiczii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)