Cattleya walkeriana

Gardner · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Cattleya

At a glance

Occurrence records60

Data sources10

Biological traits10

DNA specimens4

eDNA detections4

Sources10 archives

Databases and archives Cattleya walkeriana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility60 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF60 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB · GoaT2.9 Gbp

01Narrative

Cattleya walkeriana, or Walker's cattleya, is a species of orchid. It differs from most species of Cattleya by having inflorescences which arise from the rhizome instead of from the apex of the pseudobulb. In its native habitat (Brazilian Central Plateau) it grows as either an epiphyte or a lithophyte, sometimes in full sun. Pseudobulbs are relatively short, bulbous or fusiform, with one or two ovate leaves at the apex. Inflorescence is one- or few-flowered, about 8" (20 cm) tall. Flowers are 4-5" (9-12 cm) across.I. F. La Croix. The New Encyclopedia of Orchids: 1500 Species in Cultivation (Timber Press, 2008), p.92 Genetically C. walkeriana is close to bifoliate Cattleyas.Van den Berg, Cassio. "Reaching a compromise between conflicting nuclear and plastid phylogenetic trees: a new classification for the genus Cattleya (Epidendreae; Epidendroideae; Orchidaceae)." Phytotaxa 186.2 (2014): 75-86. [1] The diploid chromosome number of C. walkeriana has been twice determined as 2n = 40; the diploid chromosome number of the variety C. walkeriana var. princeps L.C.Menzes has been determined as 2n = 80.page 251 of L. P. Felix and M. Guerra: "Variation in chromosome number and the basic number of subfamily Epidendroideae (Orchidaceae)" Botanical Journal of the Linnean Society 163(2010)234—278. The Linnean Society of London. Downloaded October 2010 from onlinelibrary.wiley.com

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formpseudobulbous epiphyte or lithophyte

Lifeform raunkiaer detailedlithophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphytefacultative

Growth formepiphyte

Habitat GIFTCerrado (lato sensu), Floresta Ciliar ou Galeria, Floresta de Terra Firme, Floresta Estacional Decidual, Floresta Estacional Semidecidual

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cattleya walkeriana has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences6

eDNA detections4

The DNA barcodea real sequence read deposited for this species

ITSKY006870.1 ↗603 bp

ACGT

TCGAGACCGAAAAAAAATCGAGCGATTCGGAGAACTCGTGAATGCGCGGCGGCGGCTGCCGCCGCGGAACAGCCGTCCCGATCCCGGCCC …

Cattleya walkeriana voucher Or-48 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Cattleya walkeriana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 934 000 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Cattleya walkeriana2.93 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidydiploid inferred

Chromosome records40–402n range40median40mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 403×GoaT · Kew Plant DNA C-values Database · CCDB · kew · CCDB · iapt

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Jones WE, Kuehnle AR, Arumuganathan K. 1998. Nuclear DNA content of 26 Orchid (Orchidaceae) genera with emphasis on Dendrobium. Annals of Botany 82: 189-194.

CCDB · iapt — IAPT/IOPB Chromosome Data 26

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

07Deep time~11.9 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin11.9 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type60 records

Wild obs. + sensor24

Museum / vouchered34

Fossil2

Origin

Native19

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy27% within 1 km

≤100 m 6>10 km 16

22 georeferenced · 2 without coordinates

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UNESP-RClocation not on record	6
UFMGlocation not on record	3
Université de Bordeauxlocation not on record	2
UnBlocation not on record	2
UNESP-IBILCElocation not on record	2
JBRJlocation not on record	2
Jataí / Setor Industrial, BR	2
Brasília, BR	2
Kew, GB	1
Campo Grande, BR	1
Bronx, US	1
Laboratorio de Ictiologialocation not on record	1
UFMSlocation not on record	1
IPA/SPlocation not on record	1
Denver, US	1
University of Stellenboschlocation not on record	1
Feira de Santana, BR	1
UNESP, Campus São José Rio Prêtolocation not on record	1
South Kensington, GB	1
UNESP-ISlocation not on record	1
UFVJMlocation not on record	1

21 institutions · 34 of 34 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Cattleya walkeriana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)