Cattleya pumila

Hook. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Cattleya

At a glance

Occurrence records30

Data sources8

Biological traits9

DNA specimens0

eDNA detections1

Sources8 archives

Databases and archives Cattleya pumila's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility30 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF30 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 40

01Narrative

Cattleya pumila, commonly known as the dwarf sophronitis, is a species of orchid endemic to southeastern and southern Brazil.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formpseudobulbous epiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTFloresta Ombrófila (= Floresta Pluvial)

Woodinessnon-woody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cattleya pumila has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAF260196.1 ↗638 bp

ACGT

TCGAGACCGAAATATATCGAGCGATTCGGAGAACCCGTGAATGCGCGCGGCGGCAGGTGGCGTCGCGGAACAGCCGTCCGGGTCCTGGCC …

Sophronitis pumila internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cattleya pumila carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidydiploid inferred

Chromosome records40–402n range40median40mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 404×CCDB · book-fedorov · CCDB · Cave1963

CCDB · book-fedorov — Blumenschein 1960

CCDB · book-fedorov — I. 1960)

CCDB · book-fedorov — Chardard 1963

CCDB · Cave1963 — Chardard 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type30 records

Wild obs. + sensor7

Museum / vouchered23

Origin

Native20

Range

Area of Occupancy AOO88 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 5≤1 km 1

6 georeferenced · 1 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 23 records without

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
INMAlocation not on record	13
UFMGlocation not on record	3
Bronx, US	2
UFVJMlocation not on record	2
UFESlocation not on record	1
IPA/SPlocation not on record	1
Federal University of Espírito Santolocation not on record	1

7 institutions · 23 of 23 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Cattleya pumila was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)