Cattleya mendelii

Dombrain · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Cattleya

At a glance

Occurrence records64

Data sources7

Biological traits10

DNA specimens6

eDNA detections3

Sources7 archives

Databases and archives Cattleya mendelii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility64 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF64 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Cattleya mendelii is a species in the orchid genus Cattleya found in northeastern Colombia. It is typically found growing at elevations of .

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formpseudobulbous epiphyte or lithophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 800 m

Elevation min1 200 m

Epiphyteobligatory

Growth formepiphyte

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cattleya mendelii has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences6

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY008597.1 ↗632 bp

ACGT

TCGAGACCGAAATATATCGAGCGATTCGGAGAACCCGTGAATGCGCGGCGGCAGCTGGCGTCGCGGAACAGCCGTCCCGATCCCGGCCTC …

Cattleya mendelii isolate MWC1168 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type64 records

Wild obs. + sensor60

Museum / vouchered3

Cultivated / captive1

Range

Area of Occupancy AOO228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy7% within 1 km

≤100 m 4>10 km 52

56 georeferenced · 4 without coordinates

Open the mapobservation + sensor60

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1>10 km 1

2 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence3

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Pontificia Universidad Javeriana (PUJ)location not on record	1
Fundación Jardín Botánico Joaquín Antonio Uribe de Medellín (JBM)location not on record	1
Universidad Industrial de Santander (UIS)location not on record	1

3 institutions · 3 of 3 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Cattleya mendelii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)