Cattleya elongata

Barb.Rodr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Cattleya

At a glance

Occurrence records209

Data sources9

Biological traits10

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Cattleya elongata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility209 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF209 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 80

01Narrative

Cattleya elongata, the "cattleya with the elongated stalk", is an orchid species in the genus Cattleya endemic to the campo rupestre vegetation in northeastern Brazil.Genetic and morphological variability in Cattleya elongata Barb. Rodr. (Orchidaceae), endemic to the campo rupestre vegetation in northeastern Brazil. Daiane Trabuco da Cruz, Alessandra Selbach-Schnadelbach, Sabrina Mota Lambert, Patrícia Luz Ribeiro and Eduardo Leite Borba, Plant Systematics and Evolution, Volume 294, Numbers 1-2 (2011), pages 87-98, Its ploidy is 2n = 80.page 250 of L. P. Felix and M. Guerra: "Variation in chromosome number and the basic number of subfamily Epidendroideae (Orchidaceae)" Botanical Journal of the Linnean Society 163(2010)234—278. The Linnean Society of London. Downloaded October 2010 from http://onlinelibrary.wiley.com/doi/10.1111/j.1095-8339.2010.01059.x/abstract Cattleya elongata forms two natural hybrids : Cattleya × tenuata (= C. elongata × C. tenuis) (Brazil) . Cattleya × undulata ( = C. elongata × C. schilleriana) (Brazil).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formpseudobulbous lithophyte

Lifeform raunkiaer detailedlithophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteobligatory

Growth formepiphyte

Habitat GIFTVegetação Sobre Afloramentos Rochosos

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cattleya elongata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences3

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAY008619.1 ↗614 bp

ACGT

TCGAGACCGAAAAGATATCGAGCGATTCGGAGAACCCGTGAATGCGCGGCGGCGGCTGCCGCCGCGGAACAGCCGTCCCGATCCCGGCCT …

Cattleya elongata isolate MWC1170 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cattleya elongata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 80 n = 40

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 801×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 26

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

07Deep time~5.42 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin5.42 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type209 records

Wild obs. + sensor28

Museum / vouchered181

Origin

Native75

Range

Area of Occupancy AOO340 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 5≤1 km 7≤10 km 4>10 km 5

21 georeferenced · 7 without coordinates

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 1>10 km 3

4 georeferenced · 177 without coordinates

Open the institutions mapphysical evidence181

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Salvador, BR	40
Laboratorio de Ictiologialocation not on record	35
Bronx, US	23
UFBAlocation not on record	20
Feira de Santana, BR	16
CEPLAClocation not on record	11
Université de Bordeauxlocation not on record	6
Kew, GB	6
JBRJlocation not on record	6
San Jose State University, Museum of Birds and Mammalslocation not on record	3
Ilhéus, BR	2
Cruz das Almas, BR	1
CPATSAlocation not on record	1
Denver, US	1
UnBlocation not on record	1
Saint Louis, US	1
University of Stellenboschlocation not on record	1
UNICAMPlocation not on record	1
Brasília, BR	1
UNIVASFlocation not on record	1
Bogotá, D.C., CO	1
Chaguaramas, TT	1
UFRPElocation not on record	1

23 institutions · 180 of 181 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Cattleya elongata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)