Cattleya cernua

(Lindl.) Van den Berg · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Cattleya

At a glance

Occurrence records117

Data sources8

Biological traits13

DNA specimens6

eDNA detections6

Sources8 archives

Databases and archives Cattleya cernua's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility117 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF117 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Cattleya cernua — вид многолетних травянистых растений семейства Орхидные (Orchidaceae). Впервые найден недалеко от Рио-де-Жанейро Уильямом Харрисоном. Вид не имеет устоявшегося русского названия. В русскоязычных источниках обычно встречается под названием Sophronitis cernua.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formpseudobulbous epiphyte or lithophyte

Life spanperennial

Lifeform raunkiaer detailedlithophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max500 m

Elevation min0 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTFloresta Ciliar ou Galeria, Floresta Estacional Decidual, Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial), Floresta Ombrófila Mista, Restinga, Vegetação Sobre Afloramentos Rochosos

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cattleya cernua has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences9

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY008650.1 ↗633 bp

ACGT

TCGAGACCGAAACATATCGAGCGATTCGGAGAACTCGTGAATGCGCGGCGGCGGCTGGCGTCGCGGAACAGCCGTCCCGATCCTGGCCTC …

Sophronitis cernua isolate C246 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cattleya cernua carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 401×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 26

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type117 records

Wild obs. + sensor62

Museum / vouchered55

Origin

Native24

Range

Area of Occupancy AOO332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 21≤1 km 13≤10 km 13>10 km 4

51 georeferenced · 11 without coordinates

Open the mapobservation + sensor62

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 1>10 km 1

3 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
INMAlocation not on record	7
San Jose State University, Museum of Birds and Mammalslocation not on record	6
Ivano-Frankivsk, UA	6
HUENFlocation not on record	5
Blumenau, BR	4
South Kensington, GB	4
Bronx, US	2
Campo Grande, BR	2
UFMSlocation not on record	2
UFMGlocation not on record	2
JBRJlocation not on record	2
UFBAlocation not on record	1
Maringá, BR	1
Cascavel, BR	1
UFSCarlocation not on record	1
Salvador, BR	1
Universidade de Passo Fundolocation not on record	1
UNESP, Campus São José Rio Prêtolocation not on record	1
UFVJMlocation not on record	1
Pontificia Universidad Javeriana (PUJ)location not on record	1
UNESP-IBILCElocation not on record	1
Brasília, BR	1
FUVATESlocation not on record	1

23 institutions · 54 of 55 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Cattleya cernua was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.2 °C 26.2–26.2

Seasonal swing summer↔winter2.20 °C

Max temp (day)33.1 °C

Min temp (night)20.5 °C

Precipitation10.1 mm/mo

Air humidity50.8 %

Moisture balance-122 mm/mo

Vapour deficit1,666 Pa

Wind speed1.50 m/s

Cloud cover21.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)