Catoptria falsella

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Catoptria

At a glance

Occurrence records43 949

Data sources7

Biological traits0

DNA specimens68

eDNA detections80

Sources7 archives

Databases and archives Catoptria falsella's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility43 949 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI80 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics68 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF43 949 records

Environmental DNA3 datasets · 9 countries80 detections

DNA & barcodingBOLD68 specimens

01Narrative

Catoptria falsella is a species of moth of the family Crambidae. The species also goes by the common name Chequered Grass-veneer. It is found in Europe. It is nocturnal. The wingspan is 18–24 mm. The moth flies from June to September depending on the location.Fig. 2 larva after final moult The larvae feed on various mosses, especially Tortula muralis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding68 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Catoptria falsella has left across the world's sequence archives.

At a glance

DNA specimens68

BINs1

Marker genes1

eDNA detections80

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus65 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

34Gmostly conserved

92Cmostly conserved

94Amostly conserved

97Tmostly conserved

200Gmostly conserved

214Amostly conserved

229Gmostly conserved

235Cmostly conserved

289Gmostly conserved

313Tmostly conserved

364Cmostly conserved

379Tmostly conserved

400Cmostly conserved

401Cmostly conserved

412Gmostly conserved

451Amostly conserved

517Amostly conserved

559Amostly conserved

628Amostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGGATAGTGGGAACCTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.87%

Haplotypes26

BIN1

Most divergent pair3.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Catoptria apenninicasame genus6.4%Catoptria europaeicasame genus6.4%Catoptria pyramidellussame genus6.5%Catoptria speculalissame genus6.5%Catoptria casperellasame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type43 949 records

Wild obs. + sensor40 285

Museum / vouchered3 332

Other332

Origin

Native195

Range

Area of Occupancy AOO37 156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 18 615≤1 km 6 251≤10 km 11 038>10 km 204

36 108 georeferenced · 4 177 without coordinates

Open the mapobservation + sensor40 285

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 951≤1 km 989≤10 km 754>10 km 322

3 016 georeferenced · 316 without coordinates

Open the institutions mapphysical evidence3 332

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	1 119
DanishLepidopterologicalSocietylocation not on record	711
Provincia di Livornolocation not on record	375
NHMOlocation not on record	168
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	134
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	79
Salzburg, AT	68
Zürich, CH	68
SLU Artdatabankenlocation not on record	62
Tartu, EE	52
NTNU-VMlocation not on record	43
Adam Mickiewicz University in Poznańlocation not on record	29
European Distributed Institute of Taxonomy (EDIT)location not on record	27
Kuopio, FI	26
Nijmegen, NL	25
Stockholm, SE	23
Natural History Museum Rotterdamlocation not on record	23
Tallinn, EE	21
Philadelphia, US	21
DABUHlocation not on record	19
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	13
CBDClocation not on record	10
ZMAAlocation not on record	8
Rovaniemi, FI	8
neflocation not on record	7
Durban Natural Science Museumlocation not on record	6
South Kensington, GB	5
ZSMlocation not on record	3
BioFokuslocation not on record	3
Natural History Museum, Londonlocation not on record	2
MZLUlocation not on record	2
Metsähallituslocation not on record	2
NMBU:MINAlocation not on record	2
NTNU University Museum, Department of Natural Historylocation not on record	1
Brussels, BE	1
Uniwersytet Łódzkilocation not on record	1
Trondheim, NO	1

37 institutions · 3 168 of 3 332 vouchered records shown · 164 without an institution code

09Environmental DNA80 detections

Where the DNA of Catoptria falsella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found80

Studies independent surveys3

Countries9

Verifiable raw sequence linked12

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 80 detections have coordinates

Open the map9 countries0

dry grasslandFloodplain forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 12.5–20.7

Seasonal swing summer↔winter19.2 °C

Max temp (day)21.0 °C 16.4–25.5

Min temp (night)13.2 °C 7.50–15.7

Precipitation79.7 mm/mo 52.4–127

Air humidity59.0 % 55.6–62.5

Moisture balance-35.7 mm/mo -86.1–36.1

Vapour deficit773 Pa 587–1,074

Wind speed3.00 m/s 1.80–5.10

Cloud cover38.7 % 31.5–50.1

CHELSA 1981–2010, ~9 km grid, at location & month of 73 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Catoptria falsella

At a glance

Sources7 archives

At a glance

Record type43 949 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 37 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type43 949 records