Catopsis nitida — The Life Data

Plantae/Tracheophyta/Liliopsida/Poales/Bromeliaceae/Catopsis

At a glance

Occurrence records335

Data sources8

Biological traits11

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Catopsis nitida's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility335 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF335 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT · NCBI430 Mbp

01Narrative

Catopsis nitida est une espèce de plantes à fleurs de la famille des Bromeliaceae, présente dans les régions tropicales de l'Amérique centrale à la Caraïbe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formepiphyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max2 000 m

Elevation min1 000 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Catopsis nitida has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

matKKJ188789.1 ↗794 bpHonduras

ACGT

ACCATATTGCACTATGTATGTATCATTTGATAAACCCAGAAAAACCTCCTGCCTCCGGCTCAAGTAGAAATGTAAATGGAAGAATTACAA …

Catopsis nitida isolate BT36 tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK2

plant barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Catopsis nitida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size430 320 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Catopsis nitida0.43 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 50 n = 25

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 251×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Brown, G. K. & A. J. Gilmartin. 1989. Chromosome numbers in Bromeliaceae. Amer. J. Bot. 76(5): 657–665.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type335 records

Wild obs. + sensor34

Museum / vouchered301

Range

Area of Occupancy AOO760 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 19≤1 km 6≤10 km 2>10 km 2

29 georeferenced · 5 without coordinates

Open the mapobservation + sensor34

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 18≤1 km 1≤10 km 8>10 km 2

29 georeferenced · 272 without coordinates

Open the institutions mapphysical evidence301

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	68
Bronx, US	39
National Biodiversity Institute, Costa Ricalocation not on record	33
Museo Nacional de Costa Rica (MNCR)location not on record	31
Tampa, US	22
Chicago, US	17
University of Stellenboschlocation not on record	14
San José, CR	10
Durango, MX	8
León, NI	7
Mexico City, MX	6
San Francisco, US	5
St. Paul, US	5
Fort Worth, US	5
Paris, FR	3
US	2
Frankfurt am Main	2
Chicago, US	1
Guatemala, GT	1
Chongqing Museumlocation not on record	1
Chapingo, MX	1
Berlin, DE	1
Fredericksburg, US	1
Montréal, CA	1
Ciudad de México, MX	1
MEXUlocation not on record	1
Stockholm, SE	1
Montecillo, Texcoco, MX	1
Instituto de Investigaciones Botánicas y Zoológicas - Prof. Rafael M. Moscoso, Universidad Autónoma de Santo Domingolocation not on record	1
South Kensington, GB	1

30 institutions · 290 of 301 vouchered records shown · 11 without an institution code