Catopsis floribunda

L.B.Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Bromeliaceae/Catopsis

At a glance

Occurrence records295

Data sources12

Biological traits14

DNA specimens2

eDNA detections2

Sources12 archives

Databases and archives Catopsis floribunda's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility295 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF295 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT · NCBI≈825 Mbp

01Narrative

Catopsis floribunda is a species in the genus Catopsis. This species is native to the West Indies, Venezuela, Honduras, Oaxaca, and Florida.Kew World Checklist of Selected Plant FamiliesFlora of North America, Catopsis floribunda L. B. Smith, Contributions from the Gray Herbarium of Harvard University. 117:5. 1937.Espejo-Serna, A., López-Ferrari, A.R., Martínez-Correa, N. & Pulido-Esparza, V.A. (2007). Bromeliad flora of Oaxaca, Mexico: richness and distribution. Acta Botanica Mexicana 81: 71-147. Instituto de Ecología A.C..Nelson Sutherland, C.H. (2008). Catálogo de las plantes vasculares de Honduras. Espermatofitas: 1-1576. SERNA/Guaymuras, Tegucigalpa, Honduras.Hokche, O., Berry, P.E. & Huber, O. (eds.) (2008). Nuevo Catálogo de la Flora Vascular de Venezuela: 1-859. Fundación Instituto Botánico de Venezuela.Acevedo-Rodríguez, P. & Strong, M.T. (2012). Catalogue of seed plants of the West Indies. Smithsonian Contributions to Botany 98: 1-1192.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Seed mass1.38 mg

Life cycle & reproduction3

Deciduousnessevergreen

Life formepiphyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTforest

Woodinessnon-woody

Physiology & chemistry2

Leaf n13.6 mg/g

Leaf p0.91 mg/g

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Catopsis floribunda has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

matKAF539963.1 ↗827 bp

ACGT

ATGGAAGAATTACAAGGATATTTAGAAAAAGATAAATCTCGGCAACAACACTTCCTATATCCTCTTCTTTTTCAGGAGTATATTTACGCG …

Catopsis floribunda maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3

plant barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Catopsis floribunda carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈825 349 381 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Catopsis floribunda0.83 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 50 n = 25

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 501×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Gitaí, J. 2005. Chromosomal features and evolution of Bromeliaceae. Pl. Syst. Evol. 253: 65–80.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

07Deep time~2.08 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin2.08 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type295 records

Wild obs. + sensor115

Museum / vouchered180

Range

Area of Occupancy AOO804 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 30≤1 km 17≤10 km 2>10 km 49

98 georeferenced · 17 without coordinates

Open the mapobservation + sensor115

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 11≤1 km 6≤10 km 5>10 km 13

35 georeferenced · 145 without coordinates

Open the institutions mapphysical evidence180

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	46
Chicago, US	19
Saint Louis, US	19
University of Stellenboschlocation not on record	13
Durango, MX	13
Miami, US	11
St. Augustine, TT	8
EL PASO, US	4
Kew, GB	4
Instituto de Investigaciones Botánicas y Zoológicas - Prof. Rafael M. Moscoso, Universidad Autónoma de Santo Domingolocation not on record	3
Mexico City, MX	2
Tampa, US	2
Frankfurt am Main	2
Chongqing Museumlocation not on record	2
Chapingo, MX	1
Stockholm, SE	1
Tuxtla Gutiérrez, MX	1
Berlin, DE	1
Ciudad de México, MX	1
Burlington, US	1
South Kensington, GB	1
Universidad Industrial de Santander (UIS)location not on record	1
Madison, US	1

23 institutions · 157 of 180 vouchered records shown · 23 without an institution code

09Environmental DNA2 detections

Where the DNA of Catopsis floribunda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)