Catolechia wahlenbergii

(Ach.) Körb. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Rhizocarpales/Rhizocarpaceae/Catolechia

At a glance

Occurrence records555

Data sources8

Biological traits0

DNA specimens3

eDNA detections6

Sources8 archives

Databases and archives Catolechia wahlenbergii's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility555 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF555 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Catolechia is a genus of lichen-forming fungi in the family Rhizocarpaceae. It is a monotypic genus, containing the single species Catolechia wahlenbergii. The genus was circumscribed by German botanist Julius von Flotow in 1850. He did not assign a type species for the genus; Catolechia pulchella was designated as the type by Gustav Wilhelm Körber in 1855. This species is synonymous with Catolechia wahlenbergii. Several species that were originally described as a member of Catolechia have since been transferred to other genera. Examples include: Catolechia flavovirescens = Arthrorhaphis citrinella Catolechia glomerulans = Monerolechia glomerulans Catolechia lactea = Buellia lactea Catolechia marginulata = Buellia marginulata Catolechia moriopsis = Orphniospora moriopsis Catolechia pyxinoides = Pyxine pyxinoides Catolechia subcoronata = Buellia subcoronata Catolechia tenuis = Dimelaena tenuis Catolechia wahlenbergii ß alpina = Bellemerea alpina

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Catolechia wahlenbergii has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences8

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOQ626891.1 ↗469 bpChina

ACGT

TGAGACGGGGACCCTGTGCCCCGAACCTCCCATCTCTGTCTACCAACTTTTGTTGCTTCGGCGGGCCGTGCCTGGGTCCTCCTGCCCCCC …

Catolechia wahlenbergii voucher KUN18-60697 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8★ITS1

fungal barcode

08Occurrence & distribution

Record type555 records

Wild obs. + sensor254

Museum / vouchered298

Other3

Range

Area of Occupancy AOO1 504 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 138≤1 km 21≤10 km 61>10 km 5

225 georeferenced · 29 without coordinates

Open the mapobservation + sensor254

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 56≤1 km 51≤10 km 68>10 km 29

204 georeferenced · 94 without coordinates

Open the institutions mapphysical evidence298

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	51
Bergen, NO	34
Trondheim, NO	26
LDlocation not on record	25
DOI/NPS, Colonial National Historical Parklocation not on record	19
TROMlocation not on record	14
Uppsala, SE	12
Polar-Alpine Botanical Garden-Institutelocation not on record	12
Madison, US	12
Durham, US	8
Vancouver, CA	5
Kuopio, FI	4
South Kensington, GB	4
Salzburg, AT	4
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	4
Université Lavallocation not on record	4
nbflocation not on record	3
TSBlocation not on record	3
Edmonton, CA	3
Chicago, US	3
GZUlocation not on record	2
ASUlocation not on record	2
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	2
Staatsarchiv Urilocation not on record	2
MeiseBGlocation not on record	2
Berlin, DE	1
Oskarshamn, SE	1
Oulu, FI	1
BDBClocation not on record	1
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
BioFokuslocation not on record	1
Boise, US	1
Santa Barbara, US	1
National Biodiversity Institute, Costa Ricalocation not on record	1
Entomological Society of Latvialocation not on record	1
	1
SLU Artdatabankenlocation not on record	1

37 institutions · 272 of 298 vouchered records shown · 26 without an institution code

09Environmental DNA6 detections

Where the DNA of Catolechia wahlenbergii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

paa taksiden av overhengende berg (glimmersk…Maritime rocks

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 12.4–13.0

Seasonal swing summer↔winter24.3 °C

Max temp (day)14.7 °C 14.3–15.1

Min temp (night)8.50 °C 8.40–8.50

Precipitation74.7 mm/mo 58.7–90.7

Air humidity62.4 % 61.6–63.2

Vapour deficit554 Pa 532–576

Cloud cover64.6 % 64.1–65.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)