Catharanthus trichophyllus

(Baker) Pichon · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Catharanthus

At a glance

Occurrence records191

Data sources10

Biological traits15

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Catharanthus trichophyllus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility191 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS · NPASS41 compounds

Occurrence & distributionGBIF191 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 16

01Narrative

Catharanthus trichophyllus is a species of flowering plant in the family Apocynaceae. It is endemic to Madagascar, where it is most common in northern regions.Schmelzer, G. H. (2007). Catharanthus trichophyllus (Baker) Pichon. In: Schmelzer, G. H. and A. Gurib-Fakim. (Editors). Prota 11(1): Medicinal Plants/Plantes Médicinales 1. PROTA. Wageningen, Netherlands.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height0.7 m

Seed mass1.7 mg

Life cycle & reproduction4

Life formsubshrub

Life spanperennial

Raunkiær life formchamaephyte

Self fertilizationpresent

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition41 compounds

Compounds documented for Catharanthus trichophyllus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Aspidosperma type19

Yohimbine-like alkaloids6

Aspidosperma type $ Aspidosperma-Iboga hybrid type (Vinca alkaloids)5

Corynanthe type $ Strychnos type3

Corynanthe type3

Documented compounds41 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Catharanthine	present	LOTUS
(+)-Ursolic Acid	present	LOTUS
(+)-Vinblastine	present	LOTUS
(-)-Minovincinine	present	LOTUS
(5alpha,12R,19alpha)-2,3-Didehydro-6alpha,7alpha-epoxyaspidospermidine-3-carboxylic acid methyl ester	present	LOTUS
Ajmalicine	present	LOTUS
Akuammicine	present	LOTUS
Akuammigine	present	LOTUS
Catharanthin	present	LOTUS
CID 441976	present	LOTUS

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Catharanthus trichophyllus has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMH762917.1 ↗375 bpUSA · 2017

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Catharanthus trichophyllus voucher MO:6857128 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Catharanthus trichophyllus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — VEYRET, Y. 1974. Quelques donnees pour la biosystematique de pervenches malgaches (genre Catharanthus G. Don, Apocynaceae). Candollea 29: 297-307.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type191 records

Wild obs. + sensor11

Museum / vouchered180

Range

Area of Occupancy AOO348 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 7≤1 km 1

8 georeferenced · 3 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 3

5 georeferenced · 175 without coordinates

Open the institutions mapphysical evidence180

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	58
Plocation not on record	25
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	23
Saint Louis, US	23
Kew, GB	15
BMlocation not on record	4
CJBGlocation not on record	4
Stockholm, SE	2
Berlin, DE	2
WAGlocation not on record	2
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	2
University of Stellenboschlocation not on record	2
Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record	1
Mlocation not on record	1
Frankfurt am Main	1
Glocation not on record	1
University of Hamburglocation not on record	1
South Kensington, GB	1

18 institutions · 168 of 180 vouchered records shown · 12 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)