Catharanthus ovalis

Markgr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Catharanthus

At a glance

Occurrence records364

Data sources10

Biological traits14

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Catharanthus ovalis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility364 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS · NPASS34 compounds

Occurrence & distributionGBIF364 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 16

01Narrative

Catharanthus ovalis is a species of flowering plant in the dogbane family, Apocynaceae. It is endemic to Madagascar. First published as a species in 1970,Markgraf, F. 1970. Nouveaux taxons d'Apocynacées malgaches. Adansonia, n.s. 10(1): 23–33. several subspecies or varieties have been proposed, however none are now recognized. Tropicos.org. Missouri Botanical Garden. 09 Jun 2019 <http://www.tropicos.org/Name/1803434

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height0.4 m

Life cycle & reproduction4

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Self fertilizationpresent

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition34 compounds

Compounds documented for Catharanthus ovalis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Aspidosperma type17

Aspidosperma type $ Aspidosperma-Iboga hybrid type (Vinca alkaloids)7

Iboga type1

Flavonols1

Documented compounds34 total

Tissue Source Quantified only

Compound	Amount	Source
19R-Hydroxytabersonine	present	LOTUS
1H-Indolizino(8,1-cd)carbazole-5-carboxylic acid, 3a-ethyl-3a,4,5,5a,6,11,12,13a-octahydro-4,5-dihydroxy-6-methyl-, methyl ester, 4-acetate	present	LOTUS
AYFGUFZGUHLVPW-VAWQDHDZSA-N	present	NPASS
Calcium;4-Oxopentanoate;Dihydrate	present	NPASS
CMKFQVZJOWHHDV-QYWJTTNJSA-N	present	NPASS
CXBGOBGJHGGWIE-IYJDUVQVSA-O	present	NPASS
JOOXCMJARBKPKM-UHFFFAOYSA-M	present	NPASS
KLFYPJRLOIHTCM-KKILOKFGSA-N	present	NPASS
methyl (1R,12S,13R,15S,20R)-12-[(1S)-1-hydroxyethyl]-14-oxa-8,17-diazahexacyclo[10.7.1.01,9.02,7.013,15.017,20]icosa-2,4,6,9-tetraene-10-carboxylate	present	LOTUS
Methyl (1R,15R)-17-ethyl-3,13-diazapentacyclo[13.3.1.02,10.04,9.013,18]nonadeca-2(10),4,6,8,16-pentaene-1-carboxylate	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Catharanthus ovalis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

matKKT955332.1 ↗1 526 bpMadagascar

ACGT

TCCAAAGATATTTACAGCTTGATAGATCTCAACAACCCAGCTTTCTATATCCACTTATCTTTCAGGAGTATATTTATGCACTTGTTCATG …

Catharanthus ovalis voucher Ch. D Alleizette 4603 (L) maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Catharanthus ovalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — VEYRET, Y. 1974. Quelques donnees pour la biosystematique de pervenches malgaches (genre Catharanthus G. Don, Apocynaceae). Candollea 29: 297-307.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type364 records

Wild obs. + sensor139

Museum / vouchered225

Range

Area of Occupancy AOO528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 59≤1 km 26≤10 km 15>10 km 7

107 georeferenced · 32 without coordinates

Open the mapobservation + sensor139

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 223 without coordinates

Open the institutions mapphysical evidence225

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	84
Saint Louis, US	34
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	34
Plocation not on record	20
Kew, GB	20
Stockholm, SE	4
University of Stellenboschlocation not on record	3
Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record	2
Frankfurt am Main	2
Cambridge, US	1
Berlin, DE	1
Bronx, US	1
MEXUlocation not on record	1
South Kensington, GB	1

14 institutions · 208 of 225 vouchered records shown · 16 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)