Catharanthus lanceus

(Bojer ex A.DC.) Pichon · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Catharanthus

At a glance

Occurrence records263

Data sources9

Biological traits14

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Catharanthus lanceus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility263 records↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionDukesPhytochem · LOTUS · NPASS42 compounds

Occurrence & distributionGBIF263 records

DNA & barcodingNCBIsequences

01Narrative

Catharanthus lanceus grows as a perennial herb up to 1 m tall. Its fragrant flowers feature white or cream corolla lobes turning pink, reddish-violet or pink-magenta. Vernacular names for the plant include "lance-leaf periwinkle". Its habitat is on volcanic or burned soil, hillside rocks and in open woodland on ridges. Catharanthus lanceus is found from 750 - altitude. The plant is used in local medicinal treatments for toothache, fever and skin diseases, and also as a diuretic. The species is endemic to Madagascar.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height0.7 m

Life cycle & reproduction4

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Self fertilizationpresent

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition42 compounds

Compounds documented for Catharanthus lanceus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

💊 Medicinal use documented

Compound class profile5 classes

Aspidosperma type6

Corynanthe type3

Aspidosperma type $ Aspidosperma-Iboga hybrid type (Vinca alkaloids) $ Picrotoxane sesquiterpenoids2

Corynanthe type $ Yohimbine-like alkaloids2

Yohimbine-like alkaloids1

Documented compounds42 total

Tissue Source Quantified only

Compound	Class	Amount	Source
YOHIMBINE		50,000 ppm	DukesPhytochem

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Catharanthus lanceus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

matKKT955330.1 ↗1 526 bpMadagascar

ACGT

TCCAAAGATATTTACAGCTTGATAGATCTCAACAACCCAGCTTTCTATATCCACTTATCTTTCAGGAGTATATTTATGCACTTGTTCATG …

Catharanthus lanceus voucher M.R. Decary 15145 (L) maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type263 records

Wild obs. + sensor26

Museum / vouchered237

Range

Area of Occupancy AOO432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 16≤1 km 1≤10 km 3

20 georeferenced · 6 without coordinates

Open the mapobservation + sensor26

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 1≤1 km 8≤10 km 2

11 georeferenced · 226 without coordinates

Open the institutions mapphysical evidence237

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	70
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	32
Saint Louis, US	30
Plocation not on record	21
Kew, GB	9
Stockholm, SE	7
CJBGlocation not on record	6
Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record	4
Frankfurt am Main	3
South Kensington, GB	3
MAlocation not on record	2
University of Stellenboschlocation not on record	2
WAGlocation not on record	2
Bronx, US	1
BMlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Glocation not on record	1
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	1
MEXUlocation not on record	1

19 institutions · 197 of 237 vouchered records shown · 39 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)