Catesbaea parviflora

Sw. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Catesbaea

At a glance

Occurrence records130

Data sources7

Biological traits10

DNA specimens4

eDNA detections4

Sources7 archives

Databases and archives Catesbaea parviflora's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility130 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF130 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Catesbaea parviflora là một loài thực vật có hoa trong họ Thiến thảo. Loài này được Sw. mô tả khoa học đầu tiên năm 1788.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formsubshrub or shrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Catesbaea parviflora has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences5

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGQ852109.1 ↗610 bp

ACGT

ACGAATCCTGCAAAGCAGACGACCGTGAACCCGTGTATCACCCGGGCATCGGCGGATGCGTGCGGGCAGTCCCCGCCCTTCCCCGTTGCT …

Catesbaea parviflora internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type130 records

Wild obs. + sensor52

Museum / vouchered78

Range

Area of Occupancy AOO244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 15≤1 km 1>10 km 9

25 georeferenced · 27 without coordinates

Open the mapobservation + sensor52

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 2≤1 km 2≤10 km 12>10 km 14

30 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence78

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Miami, US	24
Bronx, US	14
Jena Microbial Resource Collectionlocation not on record	5
Stockholm, SE	4
Kew, GB	4
Saint Louis, US	4
South Kensington, GB	2
Wuzhou, CN	1
NHMJlocation not on record	1
Ann Arbor, US	1
University of Stellenboschlocation not on record	1
Tempe, US	1
Burlington, US	1
Fort Worth, US	1

14 institutions · 64 of 78 vouchered records shown · 14 without an institution code

09Environmental DNA4 detections

Where the DNA of Catesbaea parviflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)