Catenella caespitosa

(With.) L.M.Irvine · species

image placeholder — illustration coming later

Plantae/Rhodophyta/Florideophyceae/Gigartinales/Caulacanthaceae/Catenella

At a glance

Occurrence records6 957

Data sources8

Biological traits5

DNA specimens10

eDNA detections4

Sources8 archives

Databases and archives Catenella caespitosa's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility3 148 records↗

OBISOcean Biodiversity Information System3 809 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS6 957 records

Environmental DNA1 datasets · 4 countries4 detections

DNA & barcodingBOLD · NCBI10 specimens

01Narrative

Catenella caespitosa is a small red marine alga.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max20 m

Depth min0 m

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Catenella caespitosa has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes4

GenBank sequences9

eDNA detections4

The DNA barcodea real sequence read deposited for this species

ITSON506666.1 ↗3 787 bp

ACGT

GGTATATGCTTGTCTCAAGGACTAAGCCATGCAAGTCTAAGTATGAGTGTATTGTACAACGAAACTGCGAATGGCTCGGTAAAACAGCTA …

Catenella caespitosa voucher FH 00789173 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Solieria anastomosasame order16.7%Ahnfeltiopsis flabelliformissame order16.8%Sphaerococcus coronopifoliussame order16.9%Erythroclonium muellerisame order17.2%Neodilsea borealissame order17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL8★ITS128S

animal barcodeplant barcodefungal barcodemarker

08Occurrence & distribution

Record type6 957 records

Wild obs. + sensor2 185

Museum / vouchered2 956

Cultivated / captive1

Other1 815

Origin

Native18

Range

Area of Occupancy AOO5 652 km²

Depth

0–200 m sunlit73

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 0.2 m · max 275 m · 74 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 1 577≤1 km 149≤10 km 254>10 km 3

1 983 georeferenced · 202 without coordinates

Open the mapobservation + sensor2 185

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 91≤1 km 57≤10 km 49>10 km 13

210 georeferenced · 2 746 without coordinates

Open the institutions mapphysical evidence2 956

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Institut Francais pour l'Etude de la Merlocation not on record	490
486location not on record	277
South Kensington, GB	68
Ann Arbor, US	59
IPA/SPlocation not on record	49
DASSHlocation not on record	33
Mérida, MX	18
Durham, US	14
PNHSlocation not on record	13
UAclocation not on record	10
Pontifícia Universidade Católica do Paranálocation not on record	9
Chapel Hill, US	9
University of Stellenboschlocation not on record	8
Durham, US	6
San Diego, US	5
UEMAlocation not on record	5
Burlington, US	5
Mexico City, MX	4
Clocation not on record	4
MeiseBGlocation not on record	4
Bronx, US	3
Universidad de Oviedolocation not on record	3
McWane Science Centerlocation not on record	3
Universidad de Málagalocation not on record	3
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Granada, ES	2
Puerto Ayora, EC	2
Auckland, NZ	1
Citadel Hill, GB	1
Universidad de Autonoma de Baja Californialocation not on record	1
UFBAlocation not on record	1
Salvador, BR	1
UERJlocation not on record	1
MAlocation not on record	1
Barcelona, ES	1
Minia, EG	1
LDlocation not on record	1

37 institutions · 1 118 of 2 956 vouchered records shown · 166 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Catenella caespitosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map4 countries0

Rocky shore

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 9.00–24.3

Seasonal swing summer↔winter11.6 °C

Max temp (day)19.2 °C 10.9–25.5

Min temp (night)13.9 °C 4.70–22.5

Precipitation110 mm/mo 75.3–158

Air humidity62.4 % 57.4–63.4

Moisture balance30.1 mm/mo

Vapour deficit819 Pa 443–1,172

Wind speed3.80 m/s

Cloud cover43.1 % 35.1–50.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Catenella caespitosa

At a glance

Sources8 archives

Habitat & environment3

Other traits2

At a glance

Record type6 957 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 37 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 957 records