Catathelasma imperiale

(P.Karst.) Singer · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Biannulariaceae/Catathelasma

At a glance

Occurrence records1 121

Data sources10

Biological traits0

DNA specimens6

eDNA detections4

Sources10 archives

Databases and archives Catathelasma imperiale's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 121 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS10 compounds

Occurrence & distributionGBIF1 121 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Catathelasma imperiale is a large species of mushroom in the family Tricholomataceae. It is found in North America and Europe. It is also found and consumed in Bhutan.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition10 compounds

Compounds documented for Catathelasma imperiale across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Cholestane steroids $ Ergostane steroids4

Wax monoesters2

Furans2

Ergostane steroids1

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
(22E)-3b-Hydroxy-ergosta-5,22-dien-7-one	present	LOTUS
(3S,5R,6R,10R,13R,17R)-6-methoxy-10,13-dimethyl-17-[(E,1R)-1,4,5-trimethylhex-2-enyl]-1,2,3,4,6,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthrene-3,5-diol	present	LOTUS
22E, 24R-ergosta-7,22-diene-3beta,5alpha-diol-6beta-inoleate	present	LOTUS
22E,24R-3beta, 5alpha,6alpha-trihydroxyergosta-7, 22-diene	present	LOTUS
22E,24R-ergosta-7,22-diene-3beta,5beta,6alpha-triol	present	LOTUS
Catathelasmol A	present	LOTUS
Catathelasmol B	present	LOTUS
Catathelasmol C	present	LOTUS
Catathelasmol D	present	LOTUS
Catathelasmol E	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Catathelasma imperiale has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes1

GenBank sequences10

eDNA detections4

Countries4

The DNA barcodea real sequence read deposited for this species

ITSOP178042.1 ↗265 bpUSA · 2013

ACGT

AACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATACCTGTTTGAGTGTCATTAAATTCTCAACCTTTCCAGCTTCTTGGTCAGGCTTG …

Catathelasma imperiale voucher DBG:F-027748 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type1 121 records

Wild obs. + sensor843

Museum / vouchered276

Other2

Range

Area of Occupancy AOO2 848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy51% within 1 km

≤100 m 264≤1 km 91≤10 km 329>10 km 14

698 georeferenced · 145 without coordinates

Open the mapobservation + sensor843

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 44≤1 km 57≤10 km 85>10 km 19

205 georeferenced · 71 without coordinates

Open the institutions mapphysical evidence276

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	49
Helsinki, FI	29
Trondheim, NO	26
Turku, FI	22
WTUlocation not on record	13
SLU Artdatabankenlocation not on record	13
Göteborg, SE	12
Uppsala, SE	10
Universidade de Lisboa, Museu Bocagelocation not on record	9
WU-MYClocation not on record	8
Vancouver, CA	7
Denver, US	6
Zürich, CH	5
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	5
Chicago, US	5
TENN-Flocation not on record	4
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	4
nsnflocation not on record	4
Bronx, US	3
University of Oslo, Natural History Museumlocation not on record	2
Institute of Botany, Jagiellonian Universitylocation not on record	2
Université de Montréal Biodiversity Centrelocation not on record	2
GJOlocation not on record	2
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
TUR-Alocation not on record	1
Karlsruhe, DE	1
Orto botanico di Lucca \| Botanical Garden of Luccalocation not on record	1
Tartu, EE	1
Blacksburg, US	1
Ann Arbor, US	1
Joensuu, FI	1
W. Szafer Institute of Botany, Polish Academy of Scienceslocation not on record	1
TROMlocation not on record	1
Kyiv, UA	1
Salzburg, AT	1
National Mushroom Centre, Department of Agriculture, Ministry of Agriculture and Livestock, Bhutanlocation not on record	1

36 institutions · 255 of 276 vouchered records shown · 21 without an institution code

09Environmental DNA4 detections

Where the DNA of Catathelasma imperiale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

SmÃ¥bregnegranskog

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.6 °C 12.2–13.0

Seasonal swing summer↔winter22.2 °C

Max temp (day)15.7 °C 14.9–16.5

Min temp (night)9.10 °C 9.00–9.10

Precipitation97.0 mm/mo 89.4–105

Air humidity61.3 % 60.6–62.0

Moisture balance25.4 mm/mo 25.4–25.5

Vapour deficit568 Pa 541–596

Wind speed3.20 m/s 2.90–3.50

Cloud cover43.9 % 43.7–44.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Catathelasma imperiale

At a glance

Sources10 archives

Compound class profile4 classes

Documented compounds10 total

At a glance

Record type1 121 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 121 records