Catasetum macrocarpum

Rich. ex Kunth · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Catasetum

At a glance

Occurrence records209

Data sources9

Biological traits11

DNA specimens1

eDNA detections0

Sources9 archives

Databases and archives Catasetum macrocarpum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility209 records↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF209 records

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 54

01Narrative

Catasetum macrocarpum, the large-fruited catasetum, is a species of orchid. It is also known as the monkey goblet and monk's head orchid. It is native to the Caribbean and South America, where its distribution extends from Trinidad and Tobago to Argentina.Catasetum macrocarpum. Kew World Checklist of Selected Plant Families.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formpseudobulbous epiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max200 m

Elevation min50 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTÁrea Antrópica, Campinarana, Campo Rupestre, Cerrado (lato sensu), Floresta Ciliar ou Galeria, Floresta de Igapó, Floresta de Terra Firme, Floresta de Várzea, Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial), Restinga, Savana Amaz

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Catasetum macrocarpum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKT768386.1 ↗672 bp

ACGT

TGTCGAGACCGAAATATAAATCGAGCGATTCTGAGAAACACGTGAATCGAGCGACGGCCGTCGCCGTCGCGGGATGACCGGCCTGGCCGT …

Catasetum macrocarpum voucher BGM 96/3071 (M) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Catasetum macrocarpum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 54 n = 27

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 541×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — JONES, K. & M.G. DARKER. 1968. The chromosomes of orchids. III. Catasetinae Schltr. Kew Bull. 22: 421-427.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type209 records

Wild obs. + sensor112

Museum / vouchered97

Origin

Native42

Range

Area of Occupancy AOO528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 18≤1 km 18≤10 km 6>10 km 7

49 georeferenced · 63 without coordinates

Open the mapobservation + sensor112

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 12

14 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence97

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chaguaramas, TT	10
St. Augustine, TT	8
UFBAlocation not on record	5
Salvador, BR	5
UEMAlocation not on record	5
Universidade Federal do Rio Grande do Nortelocation not on record	4
Departamento de Sistematica e Ecologialocation not on record	3
IECOSlocation not on record	3
Museu Paraense Emílio Goeldilocation not on record	3
JBRJlocation not on record	3
Laboratorio de Ictiologialocation not on record	3
Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record	2
UFMGlocation not on record	2
UEPAlocation not on record	2
UFPElocation not on record	2
Kew, GB	2
Feira de Santana, BR	2
Chicago, US	1
Universidade Federal do Maranhãolocation not on record	1
CEPLAClocation not on record	1
Universidade Federal do Ceara, Departamento de Biologialocation not on record	1
Santarém, BR	1
Fundación Jardín Botánico Joaquín Antonio Uribe de Medellín (JBM)location not on record	1
Universidade Federal do Espírito Santolocation not on record	1
Xiamen, CN	1
Altos de Pipe, VE	1
UFPRlocation not on record	1
Federal University of Espírito Santolocation not on record	1
UFESlocation not on record	1
INMAlocation not on record	1
Seropédica, BR	1
Aarhus, DK	1
UFRRJlocation not on record	1
Fortaleza, BR	1
South Kensington, GB	1
UESBlocation not on record	1

36 institutions · 83 of 97 vouchered records shown · 14 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)