Catasetum discolor

(Lindl.) Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Catasetum

At a glance

Occurrence records420

Data sources10

Biological traits13

DNA specimens7

eDNA detections1

Sources10 archives

Databases and archives Catasetum discolor's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility420 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF420 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 108

01Narrative

Catasetum discolor, the differently colored catasetum, is a species of orchid.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formpseudobulbous geophyte or epiphyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max500 m

Elevation min180 m

Epiphyteterrestrial

Growth form detailedherb

Habitat GIFTCampinarana, Campo de Várzea, Campo Rupestre, Restinga, Savana Amazônica

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Catasetum discolor has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes8

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKU295259.1 ↗664 bpBrazil

ACGT

GCGATTCAGAGAACACGTGAATCAAGCGACGGCCGTAGCCGTCGCGAAATGACCGGCCTGGCCGTCGCCCGCGTCTCCTCCATGGGGAGA …

Catasetum discolor voucher A. Grade & H.S. Lima ADA0013 (UFMT) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL★ITS1★ITS2psbK-psbIrpoBrpoC1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Catasetum discolor carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 108 n = 54

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1081×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — JONES, K. & M.G. DARKER. 1968. The chromosomes of orchids. III. Catasetinae Schltr. Kew Bull. 22: 421-427.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type420 records

Wild obs. + sensor215

Museum / vouchered205

Origin

Native59

Range

Area of Occupancy AOO620 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 4>10 km 3

7 georeferenced · 208 without coordinates

Open the mapobservation + sensor215

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 2

3 georeferenced · 202 without coordinates

Open the institutions mapphysical evidence205

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	32
Museu Paraense Emílio Goeldilocation not on record	15
UFESlocation not on record	12
Laboratorio de Ictiologialocation not on record	11
Universidade Federal do Rio Grande do Nortelocation not on record	10
Saint Louis, US	10
Federal University of Espírito Santolocation not on record	9
Departamento de Sistematica e Ecologialocation not on record	9
Chaguaramas, TT	8
UFPElocation not on record	8
Universidade Federal de Sergipe (UFS)location not on record	8
Feira de Santana, BR	8
UFMGlocation not on record	7
San Jose State University, Museum of Birds and Mammalslocation not on record	7
Universidad Nacional de Colombia (UNAL)location not on record	6
Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record	6
Chicago, US	6
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	4
Université de Bordeauxlocation not on record	4
Salvador, BR	4
Kew, GB	3
JBRJlocation not on record	2
Universidade Federal do Espírito Santolocation not on record	2
UFBAlocation not on record	2
UFRRJlocation not on record	1
CEPLAClocation not on record	1
Universidad de los Andes (UniAndes)location not on record	1
Anton de Kom University of Surinamelocation not on record	1
Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record	1
Paris, FR	1
Brasília, BR	1
Universidad de Antioquia (UdeA)location not on record	1
Seropédica, BR	1
UNESP-RClocation not on record	1

34 institutions · 203 of 205 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Catasetum discolor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)