Catasetum barbatum

(Lindl.) Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Catasetum

At a glance

Occurrence records107

Data sources8

Biological traits11

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Catasetum barbatum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility107 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF107 records

DNA & barcodingNCBIsequences

01Narrative

Catasetum barbatum Catasetum barbatum, the bearded catasetum, is a species of orchid. It occurs commonly in Amazonas and Central Brazil. It is found in a wide variety of open, lowlands habitats, mostly riparian. It is unique in having male, female, and hermaphroditic flowers, pollinated by male euglossine bees.The IUCN Red List of Threatened Species

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formpseudobulbous epiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max220 m

Elevation min200 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTCampinarana, Cerrado (lato sensu), Floresta de Igapó, Floresta de Terra Firme, Floresta de Várzea, Floresta Ombrófila (= Floresta Pluvial), Manguezal, Palmeiral

Woodinessnon-woody

03Chemical composition4 compounds

Compounds documented for Catasetum barbatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Phenanthrenes3

Monomeric stilbenes1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
3',4-Dihydroxy-3,5'-dimethoxybibenzyl	present	LOTUS
Confusarin	present	LOTUS
Erianthridin	present	LOTUS
Nudol	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Catasetum barbatum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSMF987482.1 ↗667 bp

ACGT

GGATCATTGTCGAGACCGAATATAAATCNAGCGATTCTGAGAACACGTGAATCGAGCGACGGCCGTCGCCGTCGCGGGATGACCGGCCTG …

Catasetum barbatum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type107 records

Wild obs. + sensor12

Museum / vouchered95

Origin

Native29

Range

Area of Occupancy AOO236 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy20% within 1 km

≤100 m 2≤10 km 4>10 km 4

10 georeferenced · 2 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 26

27 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence95

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UNIVASFlocation not on record	15
Université de Bordeauxlocation not on record	14
St. Augustine, TT	8
Bronx, US	4
Universidade Federal do Maranhãolocation not on record	3
UnBlocation not on record	3
JBRJlocation not on record	3
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	3
UFPElocation not on record	2
Laboratorio de Ictiologialocation not on record	2
Feira de Santana, BR	2
CPATSAlocation not on record	1
Museu Paraense Emílio Goeldilocation not on record	1
Pontificia Universidad Javeriana (PUJ)location not on record	1
Cuiabá, BR	1
Universidade Federal do Ceara, Departamento de Biologialocation not on record	1
Chicago, US	1
Brasília, BR	1
UFMGlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Universidad Nacional de Colombia (UNAL)location not on record	1
South Kensington, GB	1
UFRPElocation not on record	1

23 institutions · 71 of 95 vouchered records shown · 24 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)