Catapodium rigidum
(L.) C.E.Hubb. · speciesAt a glance
Occurrence records76 449
Data sources11
Biological traits66
DNA specimens25
eDNA detections20
Sources11 archives
Databases and archives Catapodium rigidum's data was compiled from.
WikipediaWikimedia Foundation6 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility76 449 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics25 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources66 traits
Occurrence & distributionGBIF76 449 records
Environmental DNA1 datasets · 4 countries20 detections
DNA & barcodingBOLD · NCBI25 specimens
Genome at a glanceCCDB · GoaT3.3 Gbp
01Narrative
Catapodium rigidum, ferngrass, is a species of annual grass in the family Poaceae (true grasses), distributed around the Mediterranean and the Middle East. It has been widely introduced throughout drier parts of the world, including parts of North America, South America, South Africa, Korea, Australia, and New Zealand. Individuals can reach .
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology24
Fruit width0.45 mm
Inflorescence length max10 cm
Inflorescence length min4 cm
Leaf length65 mm
Leaf length max105 mm
Leaf length min10 mm
Leaf mass1.78 mg
Leaf size32 mm²
⚠ sources differ — TRY: 32 mm² · AusTraits: 110 mm² · LEDA: 30.5 mm² · GIFT: 30.5 mm²
Leaf width2.1 mm
Leaf width max3 mm
Leaf width min1 mm
Plant height0.12 m
⚠ sources differ — GIFT: 0.12 m · AusTraits: 0.25 m · LEDA: 0.09 m · TRY: 0.073 m
Plant height generative0.108 m
Plant height max0.44 m
Plant height min0.02 m
Seed length1.8 mm
⚠ sources differ — TRY: 1.8 mm · GIFT: 1.7 mm
Seed length max1.7 mm
Seed length min1.7 mm
Seed mass0.209 mg
⚠ sources differ — TRY: 0.209 mg · LEDA: 0.187 mg · GIFT: 0.216 mg
Seed mass max0.4 mg
Seed mass min0.16 mg
Seed width0.5 mm
Seed width max0.5 mm
Seed width min0.5 mm
Life cycle & reproduction17
Deciduousnesshibernal
⚠ sources differ — TRY: hibernal · GIFT: deciduous
Dispersal typeunspecialized
Flower length max2.5 mm
Flower length min1.5 mm
Flowering endJul
Flowering startMay
Flowering timennnnnnnnyyyn
Life formannual
Life spanannual
Lifespan years1 years
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number5 741
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max800 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: grass
Habitat GIFTÁrea Antrópica
Leaf shapeoblong
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio43.42 g/g
Leaf dry-matter content (LDMC)290 mg/g
Leaf n25.12 mg/g
Leaf p0.9 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)22.42 mm²/mg
⚠ sources differ — TRY: 22.42 mm²/mg · LEDA: 18.3 mm²/mg · GIFT: 19.68 mm²/mg
Other traits3
Diaspore typefruit with appendage
Inflorescencepanicle
Seeds per fruit>1000
05DNA & barcoding25 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Catapodium rigidum has left across the world's sequence archives.
At a glance
DNA specimens25
Marker genes5
GenBank sequences10
eDNA detections20
Countries4
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTTTGGCTAAGGGCACGCCTGCCTGGGCGTCACGCCAA …
Catapodium rigidum voucher NMW3223 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL5★rbcLa★ITS3★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Catapodium rigidum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size3 315 420 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Catapodium rigidum3.32 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidydiploid inferred
Chromosome records14–282n range14median14mode33records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1431×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · ita-fl · CCDB · nw-europe-fl +7
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · ita-fl — BRULLO S., PAVONE P., TERRASI M.C. - 1978. Numeri cromosomici per la flora italiana:494-505.. Inform. Bot. Ital. , 10(2): 278-290.
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4500
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Devesa, J. A., T. Luque & P. Gómez. 1990. Números cromosomáticos de plantas occidentales, 591--601. Anales Jard. Bot. Madrid 47: 411–417.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl
CCDB · book-ipcn67-71 — FERNANDES, A . & M. QUEIROS. 1969. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brat. 43(ser.2l: 3-140.
CCDB · book-ipcn73-74 — QUEIROS, M. 1973. Contribuicao para o conhecimento citotaxonomico dj spermatophyta de Portugal. I. Gramineae, Supl. I. Bol. Soc. Brot. I 4 7 ( Ser . 2 ) : 7 7- 1 0 3 .
CCDB · book-ipcn73-74 — KOZUHAROV, S., & A.V. PETROVA. 1974. Cytotaxonomic study on Poaceae VI. Coneptes rend. Acad. Bulg. Sci. 27: 961-964.
CCDB · book-ipcn73-74 — DAHLGREN, R., TH. KARLSSON, & P. LASSEN. 1971. Studies on the flora I < the Balearic Islands. I. Chromosome numbers in Balearic angiosperms. sot. Notiser 124: 249~269.
CCDB · book-ipcn73-74 — STRID, A. 1971. Chromosome numbers in some Albanian angiosperms. Bot. Notiser 124: 490-496.
CCDB · book-fedorov — Hubbard 1954
CCDB · book-fedorov — ABAYJIOB 1928
CCDB · book-fedorov — Parodi 1946
CCDB · book-fedorov — Delay 1947
CCDB · book-fedorov — Gould (D. n. 1964)
CCDB · book-atlas-flowering-plants — Avdulov 1931
CCDB · book-atlas-flowering-plants — Maude 1939
CCDB · kew — Bennett MD, Smith JB. (pers. comm.) Unpublished data obtained at the Plant Breeding Institute, Cambridge, UK, 1986 - 1987.
CCDB · CromoCat 2015 — Avdulov, N. P. (1928). Systematicheskaya kariologiya semeestva Gramineae. Drievnik vsesojuznogo Sezda Bot. Leningrade 1928: 65-66.
CCDB · CromoCat 2015 — Avdulov, N. P. (1931). Karyo-systematische Untersuchungen der Familie Gramineen. Bull. Appl. Bot., Genet. & Plant Breeding Suppl. 43: 1-438.
CCDB · CromoCat 2015 — Delay, C. (1947b). Recherches sur la structure des noyaux quiescents chez les Phanérogames. Rev. Cytol. et Cytophysiol. Vég. 10(1-4): 103-229.
CCDB · CromoCat 2015 — Maude, P. F. (1939). The Merton catalogue. A list of the chromosome numerals of species of British flowering plants. New Phytol. 38: 1-31.
CCDB · CromoCat 2015 — Maude, P. F. (1940). Chromosome numbers in some British plants. New Phytol. 39: 17-32.
CCDB · CromoCat 2015 — Stählin, A. (1929). Morphologische und zytologische untersuchungen an Gramineen. I-II. Wiss. Arch. Landwirtsch 1: 330-398.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1969). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brot. 43: 20-140.
CCDB · CromoCat 2015 — Queirós, M. (1973a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. I. Gramineae, supl. 1. Bol. Soc. Brot. 47: 77-103.
CCDB · CromoCat 2015 — Kozuharov, S. & Petrova, A. (1974b). Cytotaxonomic study on Poaceae. VI. Compt. Rend. Acad. Bulg. Sci. 27: 961-964.
2n 282×CCDB · iber-fl · CCDB · ipcn-api-dl
CCDB · iber-fl — Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Luque, T. & Z. Daz Lifante.Bocconea1: 303-364(1991).
CCDB · ipcn-api-dl — Luque, T. & Z. D. Lifante. 1991. Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Bocconea 1: 303–364.
n 711×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · iber-fl — Contribucin al conocimiento cariolgico de la subfam. Pooideae (Poaceae) en el SW de Espaa. Devesa, J. A. & T. Luque.Bol. Soc. Brot. ser. 261: 281-304(1988).
CCDB · iber-fl — Contribucin al conocimiento cariolgico de las Poaceae en Extremadura (Espaa). I. Devesa, J. A. & al.Bol. Soc. Brot. ser. 263: 29-66(1990).
CCDB · ipcn-api-dl — Duckert-Henriod, M. M. 1991. Mediterranean chromosome number reports 1 (7--25). Fl. Medit. 1: 229–236.
CCDB · ipcn-api-dl — Talavera, S. 1978. Aportacion al estudio cariologico de las gramineas espanolas. Lagascalia 7: 133–142.
CCDB · ipcn-api-dl — Devesa, J. A. & T. Luque. 1988. Contribución al conocimiento cariológico de la subfam. Pooideae (Poaceae) en el SW de España. Bol. Soc. Brot., sér. 2 61: 281–304.
CCDB · ipcn-api-dl — Devesa, J. A., T. RUIZ, R. Tormo, A. Muñoz, M. C. Viera, J. Carrasco, A. Ortega & J. Pastor. 1990. Contribución al conocimiento cariológico de las Poaceae en Extremadura II. Bol. Soc. Brot., sér. 2 63: 153–205.
CCDB · book-ipcn67-71 — FERNANDES, A . & M. QUEIROS. 1969. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brat. 43(ser.2l: 3-140.
CCDB · book-ipcn67-71 — DELAY, J. 1969. ouest-Mediterranee-Atlantique. Inf. Ann. Caryosyst. et Cytogenet. 3: 25-26.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1969). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brot. 43: 20-140.
CCDB · CromoCat 2015 — Talavera, S. (1978a). Aportación al estudio cariológico de las Gramineas españolas. Lagascalia 7(2): 133-142.
n 142×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Spies, J. J., T. H. Burger & S. M. C. v. Wyk. 1999. Chromosome studies on African plants. 12. The tribes of subfamily Pooideae. Bothalia 29(2): 335–341.
CCDB · CromoCat 2015 — Spies, J.J., S.M.C. Van Wyk, I.C. Nieman & E.J.L. Liebenberg (1997). Cytogenetic studies in some representatives of the subfamily Pooideae (Poaceae) in South Africa. 3. The Tribe Poeae Bothalia 27:75-82
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type76 449 records
Wild obs. + sensor73 647
Museum / vouchered2 559
Cultivated / captive6
Other237
Origin
Native8 717
Introduced1 316
Range
Area of Occupancy AOO98 996 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy30% within 1 km
≤100 m 10 553≤1 km 8 579≤10 km 44 585>10 km 589
64 306 georeferenced · 9 341 without coordinates
Open the mapobservation + sensor73 647
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy53% within 1 km
≤100 m 230≤1 km 441≤10 km 559>10 km 36
1 266 georeferenced · 1 293 without coordinates
Open the institutions mapphysical evidence2 559
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 6 records without
Open the mapnot free-living6
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions67 of 118 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Berlin, DE | 393 |
| BClocation not on record | 233 |
| Adelaide, AU | 202 |
| LDlocation not on record | 144 |
| BDBClocation not on record | 138 |
| MeiseBGlocation not on record | 133 |
| Museo Entomologico de Leonlocation not on record | 104 |
| Hobart, AU | 65 |
| Auckland, NZ | 58 |
| Moscow State Universitylocation not on record | 57 |
| South Kensington, GB | 44 |
| Canberra, AU | 40 |
| Pretoria, ZA | 36 |
| Kensington, AU | 35 |
| Mount Annan, AU | 34 |
| Wlocation not on record | 29 |
| Cape Town, ZA | 28 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 28 |
| CICYTEXlocation not on record | 27 |
| UIBlocation not on record | 26 |
| CJBGlocation not on record | 25 |
| Provincia di Livornolocation not on record | 20 |
| Bern, CH | 19 |
| Brussel, BE | 17 |
| Christchurch, NZ | 17 |
| Zürich, CH | 17 |
| Oskarshamn, SE | 15 |
| Wellington, NZ | 15 |
| BRNUlocation not on record | 13 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 13 |
| University of Stellenboschlocation not on record | 13 |
| Zürich, CH | 12 |
| Görlitz, DE | 12 |
| Dresden, DE | 12 |
| UGentlocation not on record | 12 |
| Armidale, AU | 10 |
| GJOlocation not on record | 10 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 10 |
| València, ES | 10 |
| Brisbane, AU | 10 |
| Fort Worth, US | 9 |
| MAlocation not on record | 8 |
| Pamplona, ES | 8 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 7 |
| Porrentruy, CH | 7 |
| Rotorua, NZ | 7 |
| BSBIlocation not on record | 6 |
| Austin, US | 6 |
| Kew, GB | 6 |
| Bronx, US | 5 |
| Oulu, FI | 4 |
| CASlocation not on record | 4 |
| Frankfurt am Main | 4 |
| Bourges, FR | 4 |
| Sevilla, ES | 4 |
| State Herbarium of South Australialocation not on record | 4 |
| Tsukuba, JP | 4 |
| Durban, ZA | 3 |
| Parkville, AU | 3 |
| Salzburg, AT | 3 |
| Bloomington, US | 3 |
| JBSlocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Helsinki, FI | 3 |
| BIO-UNIPIlocation not on record | 3 |
| CJBNlocation not on record | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| QVMAGlocation not on record | 2 |
| Tartu, EE | 2 |
| BGPAlocation not on record | 2 |
| BAYLUlocation not on record | 2 |
| BG-NMNHSlocation not on record | 2 |
| EL PASO, US | 2 |
| San Angelo, US | 2 |
| Emporia, US | 2 |
| Xiamen, CN | 2 |
| Frauenfeld, CH | 2 |
| Joondalup, AU | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| DBF-NHMDlocation not on record | 2 |
| NSW Office of Environment and Heritagelocation not on record | 2 |
| Saint Louis, US | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| Paris, FR | 2 |
| Boumlocation not on record | 2 |
| Olocation not on record | 1 |
| Nijmegen, NL | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| GHPG$location not on record | 1 |
| Brasília, BR | 1 |
| Museo civico di Ecologia e Storia naturale di Marano sul Panarolocation not on record | 1 |
| Uniwersytet Wrocławskilocation not on record | 1 |
| Granada, ES | 1 |
| Québec, CA | 1 |
| Torreón, MX | 1 |
| Cape Town, ZA | 1 |
| Pittsburg, US | 1 |
| Lausanne, CH | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Namur, BE | 1 |
| Mexico City, MX | 1 |
| Podgorica, ME | 1 |
| Durham, US | 1 |
| Salamanca, ES | 1 |
| BioFokuslocation not on record | 1 |
| Göteborg, SE | 1 |
| University of Patraslocation not on record | 1 |
| Córdoba, ES | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Santiago de Compostela, ES | 1 |
| Uppsala, SE | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Palmerston North, NZ | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| Rishon Le Zion, IL | 1 |
118 institutions · 2 332 of 2 559 vouchered records shown · 224 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA20 detections
Where the DNA of Catapodium rigidum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found20
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 20 detections have coordinates
Open the map4 countries0
weed in pavement at Jodrell Gate
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.0 °C 12.6–15.5
Seasonal swing summer↔winter11.1 °C
Max temp (day)17.4 °C 15.4–20.5
Min temp (night)11.3 °C 8.60–13.2
Precipitation52.9 mm/mo 31.2–78.9
Air humidity57.8 % 53.2–62.5
Moisture balance-53.6 mm/mo -112–-28.9
Vapour deficit718 Pa 577–938
Wind speed4.30 m/s 2.70–6.30
Cloud cover37.8 % 16.9–50.8
CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.