Catamixis baccharoides — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Catamixis

At a glance

Occurrence records0

Data sources6

Biological traits1

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Catamixis baccharoides's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Catamixis is a genus assigned to the family Asteraceae, with only one known species, Catamixis baccharoides, a low to medium height, ¾—1¾ m (2½—5¾ ft), shrub. It is native to a very small area of western Nepal and northern India in the Himalayas. It has approximately spoon-shaped, leathery leaves with distanced rounded teeth alternately set along straight, shyly branching stems, and carries many flower heads of about 1 cm, with a few creamy white florets, sometimes with a hint of violet, in corymbs at the end of the branches. Flowers and fruits can be found between March and May. Its vernacular name in Hindi is विषपत्री (vishpatri) or विश्पत्र (vishpatra).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Habitat & environment1

Climateseasonally dry tropical

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Catamixis baccharoides has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

matKFJ179462.1 ↗1 338 bp

ACGT

ACTCGAATGTATCAACAGAATCATTTGATTCTTTCTATTAATGATTCTAAACAGACTCCATTTTGGGGGCACCACAAGAATTTTTATTCG …

Catamixis baccharoides voucher GH:Parker barcode 00263953 maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1

plant barcode

09Environmental DNA1 detections

Where the DNA of Catamixis baccharoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.