Catalpa speciosa
(Warder ex Barney) Warder ex Engelm. · speciesAt a glance
Occurrence records7 461
Data sources9
Biological traits110
DNA specimens18
eDNA detections13
Sources9 archives
Databases and archives Catalpa speciosa's data was compiled from.
GBIFGlobal Biodiversity Information Facility7 461 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics18 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
Traits & measurements4 literature sources110 traits
Occurrence & distributionGBIF7 461 records
Environmental DNA1 datasets · 3 countries13 detections
DNA & barcodingBOLD · NCBI18 specimens
Genome at a glanceCCDB2n = 40
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology7
Leaf size20 856 mm²
Plant height23.93 m
⚠ sources differ — GIFT: 23.93 m · USDA: 18.29 m · TRY: 19.07 m
Plant height max30 m
Plant height min20 m
Seed mass19.63 mg
Seed mass max22.22 mg
Seed mass min14.91 mg
Life cycle & reproduction29
Bloom periodEarly Summer
Coppice potentialNo
Deciduousnessdeciduous
Dispersal typewind
Flower colourwhite
Flower conspicuousYes
Flowering endJul
Flowering startJun
Fruit seed period beginFall
Fruit seed period endFall
Growth rate USDARapid
Life formtree
Life spanperennial
Lifespan categoryLong
Lifespan years100 years
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Resprout abilityYes
Seed spread rateSlow
Seedling vigorMedium
Vegetative spread rateSlow
Diet & foraging1
Parasiteindependent
Habitat & environment26
Active growth periodSpring
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max800 m
Elevation min500 m
Epiphyteterrestrial
Foliage colorDark Green
Foliage porosity summerDense
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Growth formtree
Growth form USDASingle Stem
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Root depth min20 in
Shape and orientationErect
Small grainNo
Woodinesswoody
Physiology & chemistry24
Anaerobic toleranceNone
C:N ratioHigh
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementMedium
Fire resistantNo
Fire toleranceNone
Frost free days min90 days
Leaf C:N ratio27 g/g
Leaf n21.6 mg/g
Leaf p3.1 mg/g
Moisture useLow
Nitrogen fixation levelLow
Photosynthetic pathwayC3
Precipitation max80 in
Precipitation min20 in
Protein potentialLow
Salinity toleranceLow
Shade toleranceHigh
Soil pH max7 pH
Soil pH min5.5 pH
Specific leaf area (SLA)16.61 mm²/mg
Temperature min-38 °F
Uses & economy16
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Fuelwood productHigh
Lumber productYes
Naval store productNo
Nursery stock productYes
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productYes
Pulpwood productYes
Seeds per pound20 480 per lb
ToxicityNone
Veneer productNo
Other traits7
Fall conspicuousYes
Fruit seed abundanceMedium
Fruit seed conspicuousYes
Fruit seed persistenceYes
Height at 20yr6.1 m
Planting density max1 200 per acre
Planting density min100 per acre
05DNA & barcoding18 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Catalpa speciosa has left across the world's sequence archives.
At a glance
DNA specimens18
Marker genes6
GenBank sequences7
eDNA detections13
Countries3
The DNA barcodea real sequence read deposited for this species
GGGCGGTTCGCTGCCCGCGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGA …
Catalpa speciosa voucher ENC850331 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★matK-like★rbcL4★rbcLa★ITS3★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Catalpa speciosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 40 n = 20
Ploidydiploid inferred
Chromosome records40–402n range40median40mode3records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 403×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants
CCDB · ipcn-api-dl — Huang, S. f., Y. q. Wang, Z. y. Chen & X. h. Shi. 1988. Plant chromosome counts (4). Subtrop. Forest Sci. Technol. 16: 25–30.
CCDB · book-fedorov — Smith E. C. 1941
CCDB · book-atlas-flowering-plants
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type7 461 records
Wild obs. + sensor6 546
Museum / vouchered902
Cultivated / captive13
Origin
Introduced8
Range
Area of Occupancy AOO19 320 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy92% within 1 km
≤100 m 4 503≤1 km 553≤10 km 211>10 km 247
5 514 georeferenced · 1 032 without coordinates
Open the mapobservation + sensor6 546
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy49% within 1 km
≤100 m 94≤1 km 150≤10 km 219>10 km 38
501 georeferenced · 401 without coordinates
Open the institutions mapphysical evidence902
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy90% within 1 km
≤100 m 9≤10 km 1
10 georeferenced · 3 without coordinates
Open the mapnot free-living13
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions100 of 147 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Wuzhou, CN | 108 |
| Chongqing Museumlocation not on record | 48 |
| Madison, US | 38 |
| Chapel Hill, US | 34 |
| Saint Louis, US | 29 |
| Beijing, CN | 27 |
| Zhengzhou, CN | 22 |
| Williamsburg, US | 18 |
| Bronx, US | 17 |
| Fort Worth, US | 15 |
| Ann Arbor, US | 15 |
| University of New Hampshirelocation not on record | 14 |
| San Luis Obispo, US | 12 |
| Burlington, US | 11 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 10 |
| Austin, US | 10 |
| Philadelphia, US | 10 |
| WTUlocation not on record | 10 |
| Macomb, US | 10 |
| BAYLUlocation not on record | 9 |
| Bangkok, TH | 9 |
| St. Paul, US | 9 |
| Toronto, CA | 9 |
| Boise, US | 9 |
| University of Stellenboschlocation not on record | 9 |
| Mount Pleasant, US | 9 |
| Columbia, US | 9 |
| Pittsburg, US | 8 |
| Henderson State Universitylocation not on record | 8 |
| Hudson, US | 8 |
| College Park, US | 8 |
| Millersville, US | 8 |
| Jackson, US | 7 |
| McWane Science Centerlocation not on record | 7 |
| Lubbock, US | 7 |
| Denver, US | 7 |
| Norfolk, US | 6 |
| New Brunswick, US | 6 |
| Spearfish, US | 6 |
| Waverly, US | 6 |
| Minia, EG | 6 |
| Moscow State Universitylocation not on record | 5 |
| Angwin, US | 5 |
| FFPRIlocation not on record | 5 |
| MeiseBGlocation not on record | 5 |
| Emporia, US | 5 |
| Bloomington, US | 5 |
| San Diego, US | 5 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 4 |
| Chicago, US | 4 |
| Pullman, US | 4 |
| Clemson, US | 4 |
| Claremont, US | 4 |
| Green Bay, US | 4 |
| Moscow, US | 4 |
| Chadron, US | 4 |
| University of Wisconsinlocation not on record | 4 |
| Vitoria, ES | 4 |
| Davenport, US | 4 |
| Morgantown, US | 4 |
| US | 4 |
| GB | 4 |
| Fredericksburg, US | 3 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 3 |
| Riverside, US | 3 |
| New Haven, US | 3 |
| Kingston, US | 3 |
| Springfield, US | 3 |
| Flagstaff, US | 3 |
| China Agricultural Universitylocation not on record | 3 |
| Little Rock, US | 3 |
| Philadelphia, US | 3 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 3 |
| Vancouver, CA | 3 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| Northridge, US | 2 |
| University of Southern Mississippilocation not on record | 2 |
| Chicago, US | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Long Beach, US | 2 |
| San Bernardino, US | 2 |
| Cincinnati, US | 2 |
| Córdoba, AR | 2 |
| Washington, US | 2 |
| Caldwell, US | 2 |
| Ypsilanti, US | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| Pocatello, US | 2 |
| Dover, US | 2 |
| Nanjing, CN | 2 |
| Fayetteville, US | 2 |
| Stephenville, US | 2 |
| Keene State Universitylocation not on record | 2 |
| BIO-UNIPIlocation not on record | 2 |
| Dekalb, US | 2 |
| Tuscaloosa, US | 2 |
| Orem, US | 2 |
| Kunming, CN | 2 |
| Lincoln, US | 2 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 2 |
| Albuquerque, US | 2 |
| Mexico City, MX | 1 |
| IPA/SPlocation not on record | 1 |
| Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record | 1 |
| Guangzhou, CN | 1 |
| Fairfax, US | 1 |
| Texas Lutheran Universitylocation not on record | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| Kirksville, US | 1 |
| Guilin, CN | 1 |
| US | 1 |
| Harrisonburg, US | 1 |
| Yangling, CN | 1 |
| Hamilton, US | 1 |
| Jefferson City, US | 1 |
| Turlock, US | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Wlocation not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| Québec, CA | 1 |
| Capital Normal Universitylocation not on record | 1 |
| Nagasaki University - Fisherieslocation not on record | 1 |
| Guangzhou, CN | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| Nanjing, CN | 1 |
| US | 1 |
| Santa Barbara, US | 1 |
| Cheney, US | 1 |
| ASUlocation not on record | 1 |
| Görlitz, DE | 1 |
| GAlocation not on record | 1 |
| LDlocation not on record | 1 |
| Weber State Universitylocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 1 |
| Logan, US | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Conway, US | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Durango, US | 1 |
| University of Alberta Museumslocation not on record | 1 |
| University of Hamburglocation not on record | 1 |
| Knoxville, US | 1 |
147 institutions · 857 of 902 vouchered records shown · 43 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA13 detections
Where the DNA of Catalpa speciosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found13
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 13 detections have coordinates
Open the map3 countries0
Woodland; Rhamnus tomentella, Quercus kellog…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median20.1 °C 12.0–22.1
Seasonal swing summer↔winter25.8 °C
Max temp (day)24.8 °C 17.0–28.8
Min temp (night)15.9 °C 8.70–16.5
Precipitation76.5 mm/mo 30.7–92.5
Air humidity59.7 % 53.1–60.0
Moisture balance-39.1 mm/mo -118–2.70
Vapour deficit953 Pa 591–1,247
Wind speed2.50 m/s 1.60–3.60
Cloud cover37.4 % 18.5–51.8
CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.