Catalpa fargesii — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Bignoniaceae/Catalpa

At a glance

Occurrence records418

Data sources7

Biological traits7

DNA specimens4

eDNA detections3

Sources7 archives

Databases and archives Catalpa fargesii's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility418 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF418 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Catalpa fargesii, the Chinese bean tree, is a species of tree in the family Bignoniaceae, native to China. Growing to about 25 m tall, it is a deciduous tree which produces abundant pink blossom in spring, followed by narrow brown beans-like fruit in the autumn. Some sources place the species as a synonym of Catalpa bungei.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRY

Size & morphology2

Plant height23.75 m

Seed mass4.08 mg

Life cycle & reproduction1

Deciduousnessdeciduous

Habitat & environment1

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density399 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Catalpa fargesii has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMN192661.1 ↗723 bpChina

ACGT

AAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAGGATA …

Catalpa fargesii voucher OuXK-LC-004 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5PmatK1rbcL9ITS

animal barcodeplant barcodefungal barcode

08Occurrence & distribution

Record type418 records

Museum / vouchered415

Cultivated / captive2

Other1

Range

Area of Occupancy AOO584 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 2≤1 km 3≤10 km 1

6 georeferenced · 409 without coordinates

Open the institutions mapphysical evidence415

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

10Collections & institutions

Holding institutions26 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kunming, CN	89
Yangling, CN	55
Beijing, CN	50
Zhengzhou, CN	35
Central China Normal Universitylocation not on record	25
Wuhan, CN	24
Guangzhou, CN	23
Chengdu, CN	20
Guiyang, CN	12
Shanxi Universitylocation not on record	9
CASlocation not on record	8
Lanzhou, CN	6
Fort Worth, US	6
Central China Agricultural Universitylocation not on record	5
Changsha, CN	5
Xian, CN	5
Zhuzhou, CN	4
Bronx, US	4
MeiseBGlocation not on record	3
Guilin, CN	3
Shanxi Institute of Biologylocation not on record	3
Auckland, NZ	2
Christchurch, NZ	2
Seoul, KR	2
Nanjing, CN	2
New Haven, US	1
Nanyue Arboretumlocation not on record	1
Taipei, TW	1
Nanjing, CN	1
Strecker Museum, Baylor Universitylocation not on record	1
University of Stellenboschlocation not on record	1
Saint Louis, US	1
Guangzhou, CN	1
Rotorua, NZ	1
Southwest Forestry Collegelocation not on record	1
Edinburgh, GB	1

36 institutions · 413 of 415 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Catalpa fargesii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.