Catalpa bungei — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Bignoniaceae/Catalpa

At a glance

Occurrence records273

Data sources10

Biological traits21

DNA specimens4

eDNA detections2

Sources10 archives

Databases and archives Catalpa bungei's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility273 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF273 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Catalpa bungei est une espèce de plantes à fleurs de la famille des Bignoniaceae. C'est un arbre ornemental.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height15 m

Seed mass3.65 mg

⚠ sources differ — TRY: 3.65 mg · GIFT: 4.08 mg

Seed mass max4.08 mg

Seed mass min4.08 mg

Life cycle & reproduction4

Deciduousnessdeciduous

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 800 m

Elevation min1 700 m

Epiphyteterrestrial

Growth formtree

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density520 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Catalpa bungei has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences7

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW747912.1 ↗800 bp

ACGT

GGGCGGTTCGCTGCCCGCGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGA …

Catalpa bungei voucher ENC850335 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matKrbcL6ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Catalpa bungei carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 401×CCDB · eflora

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type273 records

Wild obs. + sensor27

Museum / vouchered244

Cultivated / captive1

Other1

Range

Area of Occupancy AOO636 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 5≤1 km 8>10 km 4

17 georeferenced · 10 without coordinates

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤1 km 3≤10 km 2

5 georeferenced · 239 without coordinates

Open the institutions mapphysical evidence244

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions32 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	69
Kunming, CN	53
Zhuzhou, CN	22
Zhengzhou, CN	17
Nanjing, CN	11
Xining, CN	8
Yangling, CN	6
Wuhan, CN	6
Saint Louis, US	4
Xian, CN	4
Shanxi Institute of Biologylocation not on record	3
Guangzhou, CN	3
Chengdu, CN	2
Central China Normal Universitylocation not on record	2
Capital Normal Universitylocation not on record	2
J. Rusek Collectionlocation not on record	2
Guilin, CN	2
Bronx, US	1
Inner Mongolia Universitylocation not on record	1
Kew, GB	1
Cambridge, US	1
Rotorua, NZ	1
Johnson City, US	1
Philadelphia, US	1
Columbia, US	1
Chapel Hill, US	1
Tianjin Natural History Museumlocation not on record	1
Berlin, DE	1
Guangzhou, CN	1
Hangzhou, CN	1
Shanghai, CN	1
Lanzhou, CN	1
Xian, CN	1
Vancouver, CA	1
Karlsruhe, DE	1
Bangkok, TH	1
Herbarium of South China Botanical Gardenlocation not on record	1
Guiyang, CN	1
College of the Atlantic, Museumlocation not on record	1
Wuhan, CN	1
South China Normal Universitylocation not on record	1
Shanxi Universitylocation not on record	1

42 institutions · 241 of 244 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Catalpa bungei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.0 °C 21.0–21.0

Seasonal swing summer↔winter25.4 °C

Max temp (day)25.2 °C

Min temp (night)16.4 °C

Precipitation99.3 mm/mo

Air humidity59.8 %

Moisture balance-31.4 mm/mo

Vapour deficit1000 Pa

Wind speed2.40 m/s

Cloud cover35.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.