Catabrosa aquatica
(L.) P.Beauv. · speciesAt a glance
Occurrence records28 095
Data sources12
Biological traits40
DNA specimens54
eDNA detections24
Sources12 archives
Databases and archives Catabrosa aquatica's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility28 095 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics54 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources40 traits
Occurrence & distributionGBIF28 095 records
Environmental DNA1 datasets · 9 countries24 detections
DNA & barcodingBOLD · NCBI54 specimens
Genome at a glanceCCDB · GoaT1.6 Gbp
01Narrative
Catabrosa aquatica, de noms communs Catabrose aquatique ou Canche aquatique, est une plante vivace du genre Catabrosa et de la famille des Poaceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass11.61 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 498 mm² · GIFT: 498 mm²
Plant height0.175 m
⚠ sources differ — GIFT: 0.175 m · LEDA: 0.175 m · TRY: 0.369 m
Plant height generative0.35 m
Plant height max0.7 m
Plant height min0.1 m
Seed length2.62 mm
Seed mass0.419 mg
⚠ sources differ — TRY: 0.419 mg · LEDA: 0.46 mg · GIFT: 0.398 mg
Seed mass max0.46 mg
Seed mass min0.41 mg
Life cycle & reproduction13
Deciduousnessn.d.
⚠ sources differ — TRY: n.d. · GIFT: evergreen
Dispersal typewater
⚠ sources differ — LEDA: nautochor · GIFT: anemochorous
Flowering endAug
Flowering startJun
Life formperennial or helophyte
Life spanperennial
⚠ sources differ — TRY: Perennial · LEDA: summer annuals · GIFT: perennial
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number609
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max4 900 m
Elevation mean2 160 m
Elevation min0 m
Epiphyteterrestrial
Growth formherb
⚠ sources differ — GIFT: herb · TRY: Graminoid
Habitat GIFTmeadows: wet
Mycorrhiza typenon-mycorrhizal
Woodinessnon-woody
Physiology & chemistry3
Leaf dry-matter content (LDMC)162 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)44.05 mm²/mg
Other traits1
Diaspore typeone-seeded generative dispersule
05DNA & barcoding54 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Catabrosa aquatica has left across the world's sequence archives.
At a glance
DNA specimens54
Marker genes12
GenBank sequences10
eDNA detections24
Countries9
The DNA barcodea real sequence read deposited for this species
TCGTGACCCTGACCAAAAGAGACCGTGCACGCGTCATCTAACCTGCCGGCGGCAGCAATGTTCGTCGCTTGGCCAAAGTCCTCGAAACCT …
Catabrosa aquatica voucher 1.1 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL4★rbcLa★trnL-F★ITS2★ITS1★ITS2atpF-atpHpsbK-psbIrpoBrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Catabrosa aquatica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 623 480 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Catabrosa aquatica1.62 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidypolyploid inferred
Chromosome records10–602n range20median20mode55records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2040×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · iapt +12
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Váchová M., 1980: [Report], pp. 724. - In: Löve Á. (ed.), Chromosome number reports LXIX, Taxon 29 /5-6.
CCDB · slov-fl — Váchová M. & Májovský J., 1978: [Report], pp. 381-382. - In: Löve Á. (ed.), IOPB Chromosome Number Reports LXI, Taxon 27 /4.
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · brit-fl — Jones, K. (1969)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4499
CCDB · fl-europaea — LOve & Ltfve, 1956
CCDB · poland — Pogan E., Jankun A., Wcis?o H. 1991. Further studies in chromosome numbers of Polish Angiosperms. Part XXIV. Acta Biol. Cracov. Ser. Bot. 33, 25-43.
CCDB · ipcn-api-dl — Davlianidze, M. T. 1985. Chromosome numbers in the representatives of the flora from Georgia. Bot. Zhurn. SSSR 70(5): 698–700. (In Russian).
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1983. Khromosomnye chisla nekotorykh vidov flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 2: 7–12.
CCDB · ipcn-api-dl — Rudyka, E. G. 1986. Chromosome numbers in some representatives of the Alliaceae, Fabaceae, Malvaceae, Poaceae families. Bot. Zhurn. 71: 1426–1427.
CCDB · ipcn-api-dl — Gvinianidze, Z. I. & A. A. Avazneli. 1982. Khromosomnye chisla nekotorykh predstavitelej vysokogornykh floristicheskikh kompleksov Kavkaza. Soobkskc. Akad. Nauk Gruzinskoi SSR, Inst. Bot., Trudy, Ser. Geobot. 106 (3): 577–580.
CCDB · ipcn-api-dl — Sawicka, Z. 1991. In Further studies in chromosome numbers of Polish angiosperms, part 24. Acta Biol. Cracov., Ser. Bot. 33: 37–38.
CCDB · ipcn-api-dl — Vachova, M. 1980. In Chromosome number reports LXIX. Taxon 19: 724.
CCDB · ipcn-api-dl — Engelskjon, T. 1979. Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1–38.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981. In Chromosome number reports LXX. Taxon 30: 72.
CCDB · book-ipcn75-78 — Sokolovskaya & Probatova 1977a
CCDB · book-ipcn75-78 — Vachova & Majovsky 1978
CCDB · book-ipcn75-78 — Solokovskaya & Probatova 1978
CCDB · book-ipcn75-78 — Sokolovskaya & Probatova 1975
CCDB · book-ipcn75-78 — Rostovtseva 1977
CCDB · book-northern-plants — Avdulov 1931.
CCDB · eflora
CCDB · book-fedorov — ABAYJIOB 1931
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Hubbard 1954
CCDB · book-fedorov — LOve A.
CCDB · book-fedorov — Bowden 1960a
CCDB · book-fedorov — Tateoka 1962b
CCDB · book-fedorov — CoKOJIOBCKaH, CTpeJIKOB& 1939
CCDB · book-atlas-flowering-plants — Avdulov 1931
CCDB · Cave1956 — Tutin In Love & L. b
CCDB · CromoCat 2015 — Probatova, N.S., Seledets, V.P., Rudyka, E.G., Gnutikov, A.A., Kozhevnikova, Z.V. & Barkalov V.Y. (2009). IAPT/IOPB Chromosome Data 8 Taxon 58 (4): 1284-1288
CCDB · CromoCat 2015 — Probatova, N. S. & Seledets, V. P. (2008). IAPT/IOPB Chromosome Data 5 Taxon 57(2): 553-562
CCDB · CromoCat 2015 — Váchová, M. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIX]. Taxon 29(5): 724.
CCDB · CromoCat 2015 — Rudyka, E. G. (1986). Chromosome numbers in some representatives of the Alliaceae, Fabaceae, Malvaceae, Poaceae families. Bot. Žurn. 71: 1426-1427.
CCDB · CromoCat 2015 — Sawicka, Z. (1991). In Further studies in chromosome numbers of Polish angiosperms, part 24 Acta Biologica Cracoviensia, Series Botanica 33: 37-38
CCDB · CromoCat 2015 — Váchová, M. & J. Májovský. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXI]. Taxon 27(4): 381-382.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1981d). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXX]. Taxon 30(1): 72.
2n 305×CCDB · mediterranean · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · mediterranean
CCDB · ipcn-api-dl — Nazarova, E. & A. Goukasian. 1995. Mediterranean chromosome number reports 5 (528--542). Fl. Medit. 5: 340–345.
CCDB · ipcn-api-dl — Ghukasyan. 2004. Extent of karyological study of Armenian grasses (Poaceae). Fl. Rastitel'n. Rastitel'n. Resursy Armenii 15: 85–89.
CCDB · ipcn-api-dl — Gukasyan. 2005. Cytogeographical study of the genus Catabrosa P. Beauv. (Poaceae). Pages 26--27 in Abstracts of the V International Symposium on Karyology, Karyosystematics and Molecular Phylogeny. St. Petersburg, Russia.
CCDB · CromoCat 2015 — Nazarova, E. & A. Goukasian. (1995). Reports (528-542). Fl. Medit. 5: 340-345.
2n 104×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Davlianidze, M. T. 1985. Chromosome numbers in the representatives of the flora from Georgia. Bot. Zhurn. SSSR 70(5): 698–700. (In Russian).
CCDB · book-ipcn75-78 — Sokolovskaya & Probatova 1975
CCDB · CromoCat 2015 — Davlianidze, M. (1985). Chromosome numbers in the representatives of the flora from Georgia. Bot. Žurn. 70: 698-700.
CCDB · CromoCat 2015 — Sokolovskaya, A. P. & N. S. Probatova. (1975). Chromosome numbers in some grasses (Poaceae) in the USSR flra. Bot. Žurn. 60: 667-678.
2n 222×GoaT · Kew Plant DNA C-values Database · CCDB · kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · kew — Baum A, Kenton AY, Bennett MD. (pers. comm. 1989).
2n 602×CCDB · poland · CCDB · ipcn-api-dl
CCDB · poland — Pogan E., Czapik R. and Jankun A. et al. 1985. Further studies in chromosome numbers of Polish Angiosperms Part XVIII. Acta Biol. Cracov. Ser. Bot. 27, 57-74.
CCDB · ipcn-api-dl — Pogan, E., R. CZAPIK & A. Jankun. 1985. Further studies in chromosome numbers of Polish angiosperms. Part XVIII. Acta Biol. Cracov., Ser. Bot. 27: 57–74.
2n 421×CCDB · book-fedorov
CCDB · book-fedorov — CoKOJIOBCK&H, CTpe~- Kona 1948a
2n 561×CCDB · book-fedorov
CCDB · book-fedorov — ABAYHOB 1931
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type28 095 records
Wild obs. + sensor23 107
Museum / vouchered4 885
Cultivated / captive12
Fossil1
Other90
Origin
Native4 477
Range
Area of Occupancy AOO45 792 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy41% within 1 km
≤100 m 4 662≤1 km 2 553≤10 km 9 938>10 km 379
17 532 georeferenced · 5 575 without coordinates
Open the mapobservation + sensor23 107
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy45% within 1 km
≤100 m 419≤1 km 799≤10 km 1 114>10 km 359
2 691 georeferenced · 2 194 without coordinates
Open the institutions mapphysical evidence4 885
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 12
12 georeferenced
Open the mapnot free-living12
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions116 of 214 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Moscow State Universitylocation not on record | 364 |
| LDlocation not on record | 314 |
| Olocation not on record | 288 |
| Helsinki, FI | 189 |
| Uppsala, SE | 166 |
| TROMlocation not on record | 166 |
| Oulu, FI | 156 |
| MeiseBGlocation not on record | 141 |
| Tartu, EE | 130 |
| BFLlocation not on record | 123 |
| Trondheim, NO | 115 |
| Garðabær, IS | 113 |
| Bronx, US | 87 |
| SLU Artdatabankenlocation not on record | 84 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 70 |
| Brussel, BE | 55 |
| Oskarshamn, SE | 54 |
| Bergen, NO | 53 |
| Turku, FI | 48 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 43 |
| DBF-NHMDlocation not on record | 42 |
| Tallinn, EE | 39 |
| Bern, CH | 38 |
| Adam Mickiewicz University in Poznańlocation not on record | 38 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 37 |
| 36 | |
| Moscow, US | 35 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 34 |
| Philadelphia, US | 33 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 33 |
| South Kensington, GB | 33 |
| Université Lavallocation not on record | 31 |
| Barcelona, ES | 28 |
| Logan, US | 28 |
| Missoula, US | 27 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 26 |
| Provincia di Livornolocation not on record | 26 |
| BRNUlocation not on record | 26 |
| Uniwersytet Wrocławskilocation not on record | 26 |
| Wlocation not on record | 24 |
| Québec, CA | 24 |
| Wuzhou, CN | 23 |
| University of Stellenboschlocation not on record | 23 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 22 |
| Salzburg, AT | 21 |
| GMBAlocation not on record | 21 |
| Boise, US | 20 |
| Xining, CN | 19 |
| Beijing, CN | 19 |
| Spearfish, US | 18 |
| Saint Louis, US | 18 |
| Berlin, DE | 18 |
| Entomological Society of Latvialocation not on record | 18 |
| Kuopio, FI | 18 |
| Bozeman, US | 18 |
| Provo, US | 17 |
| Lincoln, US | 17 |
| Dresden, DE | 17 |
| Chongqing Museumlocation not on record | 17 |
| Natural History Museum Rotterdamlocation not on record | 16 |
| Denver, US | 16 |
| Pocatello, US | 16 |
| BDBClocation not on record | 16 |
| Vitoria, ES | 15 |
| Corvallis, US | 14 |
| Chengdu, CN | 14 |
| BSBIlocation not on record | 13 |
| KMNlocation not on record | 13 |
| Zürich, CH | 13 |
| BIO-UNIPIlocation not on record | 13 |
| Chadron, US | 13 |
| Bloomington, US | 12 |
| Zürich, CH | 12 |
| Mlocation not on record | 12 |
| Kandalaksha State Nature Reservelocation not on record | 12 |
| Flagstaff, US | 11 |
| Caldwell, US | 10 |
| València, ES | 10 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 10 |
| Riverside, US | 10 |
| Auckland, NZ | 10 |
| WTUlocation not on record | 10 |
| Kew, GB | 10 |
| Montréal, CA | 10 |
| University of Alberta Museumslocation not on record | 9 |
| Irkutsk State Universitylocation not on record | 9 |
| Urumqi, CN | 8 |
| Pullman, US | 8 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 8 |
| TUR-Alocation not on record | 8 |
| MAlocation not on record | 8 |
| Henderson, US | 8 |
| ASUlocation not on record | 7 |
| Orem, US | 7 |
| Tampa, US | 7 |
| Seoul, KR | 7 |
| WINlocation not on record | 7 |
| GJOlocation not on record | 7 |
| BClocation not on record | 7 |
| Tromso University Museumlocation not on record | 6 |
| Uniwersytet Jagiellońskilocation not on record | 6 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 6 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 6 |
| Salamanca, ES | 6 |
| CJBGlocation not on record | 6 |
| Nijmegen, NL | 5 |
| Bourges, FR | 5 |
| CJBNlocation not on record | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| Weber State Universitylocation not on record | 5 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 5 |
| Guangzhou, CN | 5 |
| Porrentruy, CH | 4 |
| Edinburgh, GB | 4 |
| Porvoo, FI | 4 |
| nbflocation not on record | 4 |
| Tilburg, NL | 4 |
| Frankfurt am Main | 4 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 4 |
| Yangling, CN | 4 |
| Eastern Nevada Landscape Coalitionlocation not on record | 4 |
| Bangkok, TH | 4 |
| Karlsruhe, DE | 4 |
| Paris, FR | 4 |
| Taipei, TW | 4 |
| Xiamen, CN | 3 |
| Rocky Mountain Biological Laboratorylocation not on record | 3 |
| University of Lethbridgelocation not on record | 3 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 3 |
| Frauenfeld, CH | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 3 |
| Kunming, CN | 3 |
| Whitehorse, CA | 3 |
| Museo Achille Folettolocation not on record | 3 |
| Namur, BE | 3 |
| Vancouver, CA | 3 |
| San Isidro, AR | 3 |
| National Museum Waleslocation not on record | 3 |
| Claremont, US | 3 |
| Pittsburg, US | 3 |
| San Luis Obispo, US | 3 |
| Jyväskylä, FI | 3 |
| Albuquerque, US | 3 |
| H-Adlerlocation not on record | 3 |
| San Angelo, US | 3 |
| Pamplona, ES | 3 |
| Görlitz, DE | 3 |
| Herbario Universidad de Concepciónlocation not on record | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| Naturhistorische Gesellschaft Nürnberg e.V.location not on record | 2 |
| H-Hohlalocation not on record | 2 |
| CASlocation not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| USFS/BHSClocation not on record | 2 |
| Winterthur, CH | 2 |
| PRClocation not on record | 2 |
| Granada, ES | 2 |
| PrivatHerblocation not on record | 2 |
| Sevilla, ES | 2 |
| Boumlocation not on record | 2 |
| SZUlocation not on record | 2 |
| Durham, US | 2 |
| Grand Junction, US | 2 |
| Dhaka, BD | 2 |
| Podgorica, ME | 2 |
| Stockholm, SE | 2 |
| Jiangxi College of Educationlocation not on record | 2 |
| Dekalb, US | 2 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 1 |
| Fort Worth, US | 1 |
| Glarus, CH | 1 |
| Columbia, US | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Phoenix, US | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| Tuscaloosa, US | 1 |
| NMBU:MINAlocation not on record | 1 |
| Madison, US | 1 |
| University of Hulllocation not on record | 1 |
| Göteborg, SE | 1 |
| H-HarzKurtlocation not on record | 1 |
| Lanzhou, CN | 1 |
| Dehra Dun, IN | 1 |
| University of Hamburglocation not on record | 1 |
| Angwin, US | 1 |
| Awka, NG | 1 |
| AUAlocation not on record | 1 |
| LfUlocation not on record | 1 |
| FLADlocation not on record | 1 |
| Uniwersytet Warszawskilocation not on record | 1 |
| Pretoria, ZA | 1 |
| No collectionlocation not on record | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Regensburgische Botanische Gesellschaftlocation not on record | 1 |
| Bandelier National Monumentlocation not on record | 1 |
| Staten Island, US | 1 |
| Castelar, AR | 1 |
| Ciudad Autónoma de Buenos Aires, AR | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Montréal, CA | 1 |
| Ashland, US | 1 |
| Alicante, ES | 1 |
| GINRlocation not on record | 1 |
| UGentlocation not on record | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Mississippi State, US | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record | 1 |
| NTNU University Museum, Department of Natural Historylocation not on record | 1 |
| Lausanne, CH | 1 |
| Saint John, CA | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Rishon Le Zion, IL | 1 |
214 institutions · 4 470 of 4 885 vouchered records shown · 387 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA24 detections
Where the DNA of Catabrosa aquatica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found24
Studies independent surveys1
Countries9
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 24 detections have coordinates
Open the map9 countries0
Plant growing in the middle of the stream ad…Plant growing in the middle of the stream ad…nursery
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.8 °C 4.30–15.2
Seasonal swing summer↔winter15.3 °C
Max temp (day)15.1 °C 7.10–20.4
Min temp (night)8.50 °C 1.80–11.4
Precipitation91.2 mm/mo 36.6–149
Air humidity62.5 % 54.6–67.7
Moisture balance-10.1 mm/mo
Vapour deficit547 Pa 364–729
Wind speed4.20 m/s
Cloud cover48.9 % 32.7–66.1
CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.