Casuarina pauper

F.Muell. ex Miq. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fagales/Casuarinaceae/Casuarina

At a glance

Occurrence records82

Data sources5

Biological traits41

DNA specimens2

eDNA detections2

Sources5 archives

Databases and archives Casuarina pauper's data was compiled from.

GBIFGlobal Biodiversity Information Facility82 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources41 traits

Occurrence & distributionGBIF82 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology16

Fruit length6.25 mm

Leaf length80.66 mm

Leaf length max1.8 mm

Leaf length min1 mm

Leaf mass89.57 mg

Leaf mass per area584 g/m2

Leaf size100 mm²

⚠ sources differ — TRY: 100 mm² · AusTraits: 123 mm²

Leaf width1.12 mm

Leaf width max1.8 mm

Leaf width min1 mm

Plant height15 m

⚠ sources differ — AusTraits: 15 m · TRY: 7.5 m

Plant height max20 m

Plant height min5 m

Seed length6 mm

Seed mass1.71 mg

⚠ sources differ — TRY: 1.71 mg · AusTraits: 1.85 mg

Seed width6.23 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typewind

Life formtree

Life spanperennial

Pollination syndromewind

Raunkiær life formphanerophyte

Resprouting capacityfire_killed

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typesamara

Growth formtree

Leaf compoundnesssimple

Leaf shapeterete

Woodinesswoody

Physiology & chemistry5

Leaf dry-matter content (LDMC)918 mg/g

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)1.68 mm²/mg

Wood density972 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Casuarina pauper has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHM116957.1 ↗803 bpAustralia

ACGT

GGCGGTTCGCTGCCGGCGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAA …

Casuarina pauper internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type82 records

Wild obs. + sensor77

Museum / vouchered5

Range

Area of Occupancy AOO260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 38≤1 km 9≤10 km 5>10 km 12

64 georeferenced · 13 without coordinates

Open the mapobservation + sensor77

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
EL PASO, US	3
Auckland, NZ	2

2 institutions · 5 of 5 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Casuarina pauper was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)