Casuarina equisetifolia
speciesAt a glance
Occurrence records11 121
Data sources16
Biological traits144
DNA specimens17
eDNA detections169
Sources16 archives
Databases and archives Casuarina equisetifolia's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility11 121 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI169 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics17 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources144 traits
Chemical compositionLOTUS · NPASS62 compounds
Occurrence & distributionGBIF11 121 records
Environmental DNA2 datasets · 6 countries169 detections
DNA & barcodingBOLD · NCBI17 specimens
Genome at a glanceCCDB · GIFT · GoaT587 Mbp
01Narrative
Le filao, ou filao à feuilles de prêle ou pin australien, est une espèce de plantes à fleurs dicotylédones famille des Casuarinaceae, originaire d'Asie du Sud-Est et d'Australie. C'est un arbre pouvant atteindre 35 m de haut, au feuillage persistant, au bois très dur, surnommé « bois de fer », qui s'adapte à tous types de sols et est tolérant au sel.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsUSDATRY
Size & morphology22
Fruit length7.5 mm
Fruit length max22 mm
Fruit length min6 mm
Fruit width11 mm
Inflorescence length max4 cm
Inflorescence length min0.7 cm
Leaf length6 mm
⚠ sources differ — AusTraits: 6 mm · GIFT: 2 mm
Leaf length max3 mm
Leaf length min0.5 mm
Leaf width0.6 mm
Leaf width max1 mm
Leaf width min0.3 mm
Plant height30 m
⚠ sources differ — GIFT: 30 m · AusTraits: 12 m · USDA: 30.48 m · TRY: 30 m
Plant height max50 m
Plant height min5 m
Seed length4 mm
Seed length max7 mm
Seed length min6 mm
Seed mass3.19 mg
⚠ sources differ — TRY: 3.19 mg · AusTraits: 2 mg · GIFT: 2.71 mg
Seed mass max20 mg
Seed mass min1 mg
Seed width1.5 mm
Life cycle & reproduction40
Bloom periodMid Spring
Coppice potentialNo
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typewater+wind
⚠ sources differ — AusTraits: anemochory hydrochory · GIFT: hydrochorous
Flower colourred
Flower conspicuousNo
Flower length max24 mm
Flower length min10 mm
Flower width max13 mm
Flower width min9 mm
Flowering endSep
Flowering startJul
Flowering timenyyyyyyyynnn
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formtree
Life spanperennial
Lifespan categoryShort
Lifespan years45 years
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsYes
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Resprout abilityNo
Resprouting capacityfire_killed
Seed spread rateRapid
Seedling vigorHigh
Self fertilizationabsent
Sex typemonoecious
Vegetative spread rateSlow
Diet & foraging1
Parasiteindependent
Habitat & environment34
Active growth periodSpring, Summer, Fall
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatewet tropical
Climberself-supporting
Elevation max2 650 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterDense
Foliage textureFine
Fruit colourbrown
Fruit fleshinessdry
Fruit typesamara
⚠ sources differ — AusTraits: samara · GIFT: nut
Growth formtree
Growth form USDASingle Stem
Habitat GIFTbeach, on sand near high water mark, also in coastal bushland, widely planted
Hedge toleranceMedium
Known allelopathNo
Leaf compoundnesssimple
Leaf formscale-like
Leaf retentionYes
Leaf shapeterete
Low growing grassNo
Mycorrhiza typeectomycorrhizal
Root depth min24 in
Shape and orientationErect
Small grainNo
Succulenceno
Woodinesswoody
Physiology & chemistry25
Anaerobic toleranceLow
C:N ratioHigh
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementLow
Fire resistantNo
Fire toleranceNone
Frost free days min300 days
Leaf C:N ratio35.21 g/g
Leaf n16.25 mg/g
Leaf p0.64 mg/g
Moisture useMedium
Nitrogen fixation levelLow
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min25 in
Salinity toleranceHigh
Shade toleranceHigh
Soil pH max8.8 pH
Soil pH min6.2 pH
Specific leaf area (SLA)3.02 mm²/mg
Temperature min22 °F
Wood density805 mg/cm³
⚠ sources differ — TRY: 805 mg/cm³ · GIFT: 859 mg/cm³
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Fuelwood productHigh
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound325 000 per lb
ToxicityNone
Veneer productNo
Other traits8
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Height at 20yr15.24 m
Inflorescencespike
Planting density max700 per acre
Planting density min300 per acre
03Chemical composition62 compounds
Compounds documented for Casuarina equisetifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Oleanane triterpenoids22
Dibenzylbutane lignans8
Aminoacids4
Simple phenolic acids4
Flavonols3
Documented compounds62 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Acuminatin | present | NPASS | |
| (+)-Erythrodiol | present | LOTUS | |
| (+)-Valine | present | LOTUS | |
| (-)-Dihydroguaiaretic acid | present | NPASS | |
| (-)-Licarin A | present | NPASS | |
| (18|A)-Oleanolic acid | present | LOTUS | |
| (1R,2S,3R,6S,8R)-2,3,5,6,7,8-hexahydro-1H-pyrrolizine-1,2,3,6,7-pentol | present | LOTUS | |
| (2S,3S)-2-(3,4-Dimethoxyphenyl)-2,3-dihydro-7-methoxy-3-methyl-5-benzofurancarboxaldehyde | present | NPASS | |
| (2S,3S)-2-(4-hydroxy-3-methoxyphenyl)-7-methoxy-3-methyl-2,3-dihydro-1-benzofuran-5-carbaldehyde | present | NPASS | |
| (3aS,6aR,9R,9aS,9bS)-9-hydroxy-9-methyl-3,6-dimethylidene-3a,4,5,6a,7,8,9a,9b-octahydroazuleno[4,5-b]furan-2-one | present | NPASS |
05DNA & barcoding17 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Casuarina equisetifolia has left across the world's sequence archives.
At a glance
DNA specimens17
Marker genes3
GenBank sequences10
eDNA detections169
Countries6
The DNA barcodea real sequence read deposited for this species
AAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCTGGAGTTCCACCT …
Casuarina equisetifolia voucher Peru18308 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL9★rbcLa
plant barcode
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Casuarina equisetifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size586 800 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Casuarina equisetifolia0.59 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records18–242n range18median18mode11records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1810×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-indian_vol1 +4
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ipcn-api-dl — Morawetz, W. & M. R. A. Samuel. 1989. Karyological patterns in the Hamamelidae. Syst. Assoc. Special Vol. 40(2): 131–135.
CCDB · ipcn-api-dl — Jarolĭmovă. 1994. Chromosome counts of some Cuban angiosperms. Folia Geobot. Phytotax. 29: 101–106.
CCDB · book-indian_vol1 — Swamy, B.G.L. 1948 ; Barlow, B.A. 1959
CCDB · book-fedorov — Swamy 1948
CCDB · book-fedorov — Barlow 1959a
CCDB · kew — Ohri D. (pers comm. 1996)
CCDB · Cave1959 — Barlow 1959a
GIFT · GIFT (floras)
2n 241×CCDB · book-atlas-flowering-plants
CCDB · book-atlas-flowering-plants — Wetzel 1929
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid2×GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · Kew Plant DNA C-values Database
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
08Occurrence & distribution
Record type11 121 records
Wild obs. + sensor8 548
Museum / vouchered2 234
Cultivated / captive6
Other333
Origin
Native34
Introduced118
Range
Area of Occupancy AOO20 352 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy82% within 1 km
≤100 m 4 662≤1 km 996≤10 km 865>10 km 388
6 911 georeferenced · 1 637 without coordinates
Open the mapobservation + sensor8 548
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy64% within 1 km
≤100 m 211≤1 km 177≤10 km 171>10 km 49
608 georeferenced · 1 626 without coordinates
Open the institutions mapphysical evidence2 234
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 6 records without
Open the mapnot free-living6
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions147 of 279 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Durango, MX | 99 |
| Paris, FR | 81 |
| Bronx, US | 68 |
| Palmerston, AU | 62 |
| Université de Strasbourglocation not on record | 58 |
| Tampa, US | 54 |
| Saint Louis, US | 50 |
| Honolulu, US | 48 |
| Baroda, IN | 47 |
| Taipei, TW | 43 |
| Smithfield, AU | 43 |
| Jena Microbial Resource Collectionlocation not on record | 40 |
| University of Stellenboschlocation not on record | 40 |
| Miami, US | 32 |
| Mexico City, MX | 29 |
| TAIElocation not on record | 26 |
| BISHlocation not on record | 24 |
| Kew, GB | 23 |
| Museo Entomologico de Leonlocation not on record | 21 |
| Beijing, CN | 20 |
| Mérida, MX | 18 |
| Adam Mickiewicz University in Poznańlocation not on record | 18 |
| College of the Atlantic, Museumlocation not on record | 17 |
| IFAN Ch. A. Dioplocation not on record | 17 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 16 |
| Canberra, AU | 16 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 15 |
| Nishihara, JP | 15 |
| Tapachula, MX | 14 |
| Auckland, NZ | 14 |
| Uniwersytet Śląski w Katowicachlocation not on record | 14 |
| Guangzhou, CN | 13 |
| Valparaiso, CL | 12 |
| Bloomington, US | 11 |
| Puerto Ayora, EC | 11 |
| Brisbane, AU | 11 |
| Mexico City, MX | 11 |
| MeiseBGlocation not on record | 11 |
| Stockholm, SE | 11 |
| Chicago, US | 10 |
| Bangkok, TH | 10 |
| Austin, US | 10 |
| Plocation not on record | 10 |
| Flagstaff, US | 10 |
| Kunming, CN | 10 |
| Durban, ZA | 10 |
| Blumenau, BR | 10 |
| Guilin, CN | 10 |
| Riverside, US | 9 |
| Tsukuba, JP | 9 |
| BAYLUlocation not on record | 9 |
| Leiden University Medical Centerlocation not on record | 9 |
| Moscow State Universitylocation not on record | 8 |
| Universidad de Antioquia (UdeA)location not on record | 8 |
| Conservatoire Botanique National de Mascarinlocation not on record | 8 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 8 |
| Mexico City, MX | 8 |
| EL PASO, US | 8 |
| Fortaleza, BR | 8 |
| Guizhou Forestry Schoollocation not on record | 8 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 7 |
| Canadian Department of Agriculturelocation not on record | 7 |
| CICYTEXlocation not on record | 7 |
| Wuzhou, CN | 7 |
| Mérida, MX | 7 |
| Universidad de Caldas (UCaldas)location not on record | 7 |
| UNESClocation not on record | 7 |
| Nishihara, JP | 7 |
| Criciúma, BR | 7 |
| Masindi, UG | 6 |
| Wlocation not on record | 6 |
| Long Beach, US | 6 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 6 |
| James Cook Townsvillelocation not on record | 6 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 6 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 6 |
| Antiguo Cuscatlán, SV | 6 |
| Fort Worth, US | 6 |
| Chongqing Museumlocation not on record | 6 |
| South Kensington, GB | 6 |
| LDlocation not on record | 6 |
| Hanshan Normal Universitylocation not on record | 6 |
| Kensington, AU | 6 |
| Toyama, JP | 5 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 5 |
| Ciudad de México, MX | 5 |
| Pondicherry, IN | 5 |
| Taipei, TW | 5 |
| Berlin, DE | 5 |
| Mississippi State, US | 5 |
| Universidade Federal de Sergipe (UFS)location not on record | 5 |
| UFBAlocation not on record | 5 |
| Siouxland Heritage Museumlocation not on record | 5 |
| Tuxtla Gutiérrez, MX | 5 |
| Badajoz, ES | 4 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 4 |
| UFRRJlocation not on record | 4 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 4 |
| Herbier National du Gabonlocation not on record | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| Claremont, US | 4 |
| MAlocation not on record | 4 |
| Salvador, BR | 4 |
| Mount Annan, AU | 4 |
| Hobart, AU | 4 |
| Philadelphia, US | 3 |
| Yaoundé, CM | 3 |
| Universidad Industrial de Santander (UIS)location not on record | 3 |
| Universidad de La Salle (La Salle)location not on record | 3 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 3 |
| WAGlocation not on record | 3 |
| LBVlocation not on record | 3 |
| McWane Science Centerlocation not on record | 3 |
| UFSClocation not on record | 3 |
| Xiamen, CN | 3 |
| PUC-RSlocation not on record | 3 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 3 |
| UFRPElocation not on record | 3 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 3 |
| SCAUlocation not on record | 3 |
| Chapingo, MX | 3 |
| San Jose, US | 3 |
| JBRJlocation not on record | 3 |
| Christchurch, NZ | 3 |
| Burlington, US | 3 |
| Asheville, US | 3 |
| Dresden, DE | 3 |
| Zapopan, MX | 3 |
| Shanghai, CN | 3 |
| Millersville, US | 3 |
| Pretoria, ZA | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| Nanjing, CN | 3 |
| HNBlocation not on record | 2 |
| Logan, US | 2 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 2 |
| Victoria, CA | 2 |
| J.F.Oberlin Universitylocation not on record | 2 |
| Universidad Nacional de Colombia (UNAL)location not on record | 2 |
| Santa Maria, BR | 2 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 2 |
| Yunnan Universitylocation not on record | 2 |
| Chengdu, CN | 2 |
| Kagoshima, JP | 2 |
| Mlocation not on record | 2 |
| Nanjing, CN | 2 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 2 |
| Uppsala, SE | 2 |
| Nagasaki University - Fisherieslocation not on record | 2 |
| La Paz, MX | 2 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 2 |
| nlocation not on record | 2 |
| Mexico City, MX | 2 |
| Gujarat Biodiversity Gene Banklocation not on record | 2 |
| Frankfurt am Main | 2 |
| Catalina Island Conservancylocation not on record | 2 |
| Austin, US | 2 |
| Durango, US | 2 |
| Altos de Pipe, VE | 2 |
| UTFPR-CPlocation not on record | 2 |
| UNESP-RClocation not on record | 2 |
| Ojo, NG | 2 |
| Laboratorio de Ictiologialocation not on record | 2 |
| BMlocation not on record | 2 |
| EMTCMlocation not on record | 2 |
| Cambridge University Herbariumlocation not on record | 2 |
| San Francisco, US | 2 |
| Loja, EC | 2 |
| Phoenix, US | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| Provo, US | 2 |
| HAWlocation not on record | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| Zacatecas, MX | 2 |
| Peking Universitylocation not on record | 2 |
| Chaguaramas, TT | 2 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 2 |
| BClocation not on record | 2 |
| Tlalnepantla, MX | 2 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 2 |
| València, ES | 2 |
| Maringá, BR | 2 |
| Sanda, JP | 2 |
| Sendai, JP | 2 |
| Görlitz, DE | 2 |
| POZGlocation not on record | 2 |
| Hangzhou, CN | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| Chinese Academy of Forestrylocation not on record | 2 |
| Instituto do Meio Ambientelocation not on record | 2 |
| Angwin, US | 2 |
| arosemena tola, EC | 2 |
| US | 2 |
| CEPLAClocation not on record | 1 |
| UPNlocation not on record | 1 |
| Arequipa, PE | 1 |
| UC_PESHlocation not on record | 1 |
| Chicago, US | 1 |
| Pomona Collegelocation not on record | 1 |
| UnBlocation not on record | 1 |
| Durham, US | 1 |
| MEXUlocation not on record | 1 |
| Guasave, MX | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Davis, US | 1 |
| Université du Lomélocation not on record | 1 |
| University of Hamburglocation not on record | 1 |
| ASUlocation not on record | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| Llocation not on record | 1 |
| Cuenca, EC | 1 |
| Bogotá, D.C., CO | 1 |
| Pullman, US | 1 |
| UFERSAlocation not on record | 1 |
| San Diego, US | 1 |
| Palmerston North, NZ | 1 |
| Dover, US | 1 |
| GAlocation not on record | 1 |
| UIBlocation not on record | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
| Irvine, US | 1 |
| Clemson, US | 1 |
| Ann Arbor, US | 1 |
| Adelaide, AU | 1 |
| Institute for Agricultural Research of Mozambiquelocation not on record | 1 |
| Montréal, CA | 1 |
| SIHUlocation not on record | 1 |
| Seychelles National Herbariumlocation not on record | 1 |
| UNIVILLElocation not on record | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| Whitehorse, CA | 1 |
| Federal University of Espírito Santolocation not on record | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| Goucher Collegelocation not on record | 1 |
| INMAlocation not on record | 1 |
| UFESlocation not on record | 1 |
| San Luis Obispo, US | 1 |
| Cibinong, ID | 1 |
| Whitewater, US | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Arizona Western Collegelocation not on record | 1 |
| Wollongong, AU | 1 |
| Ivano-Frankivsk, UA | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Brasília, BR | 1 |
| Santa Teresa, BR | 1 |
| Vancouver, CA | 1 |
| Cruz das Almas, BR | 1 |
| Universidade Federal do Espírito Santolocation not on record | 1 |
| Strecker Museum, Baylor Universitylocation not on record | 1 |
| CMULlocation not on record | 1 |
| Turlock, US | 1 |
| Mazatlán, MX | 1 |
| FUVATESlocation not on record | 1 |
| Northridge, US | 1 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| Changsha, CN | 1 |
| National Herbarium & Botanic Gardens of Malawilocation not on record | 1 |
| Beijing, CN | 1 |
| TNMlocation not on record | 1 |
| Torreón, MX | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Green Bay, US | 1 |
| JP | 1 |
| Weber State Universitylocation not on record | 1 |
| Guatemala City, GT | 1 |
| CPATSAlocation not on record | 1 |
| Arcata, US | 1 |
| Campo Mourão, BR | 1 |
| BIO-UNIPIlocation not on record | 1 |
| Calabar, NG | 1 |
| Chengdu, CN | 1 |
| Olocation not on record | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| Denver, US | 1 |
| Bern, CH | 1 |
279 institutions · 1 899 of 2 234 vouchered records shown · 333 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA169 detections
Where the DNA of Casuarina equisetifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found169
Studies independent surveys2
Countries6
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 169 detections have coordinates
Open the map6 countries0
GardenCoastal Sage Scrub/Ruderal vegetation with I…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Measured at samplingin-field
Temperature21.1 °C 6.96–27.9
pH8.18 6.79–8.40
Conductivity44,900 µS/cm 32,100–56,562
Salinity35.4 PSU 26.1–36.0
Dissolved oxygen7.36 mg/L 6.51–8.70
Turbidity0.316 NTU 0.006–3.70
Nitrate0.806 µmol/L 0.102–10.8
Depth1.00 m 0–750
Coastal waterSedimentPelagic
145 samples with on-site data · median with range · describes the sample, not the organism
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.7 °C 13.2–21.6
Seasonal swing summer↔winter8.50 °C
Max temp (day)19.2 °C 15.6–23.3
Min temp (night)14.6 °C 10.7–19.3
Precipitation98.3 mm/mo 58.1–126
Air humidity58.3 % 55.1–61.6
Moisture balance7.60 mm/mo
Vapour deficit806 Pa 669–978
Wind speed5.00 m/s
Cloud cover23.0 % 16.2–28.8
CHELSA 1981–2010, ~9 km grid, at location & month of 157 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.