Castilleja thompsonii

Pennell · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Orobanchaceae/Castilleja

At a glance

Occurrence records1 562

Data sources9

Biological traits12

DNA specimens5

eDNA detections3

Sources9 archives

Databases and archives Castilleja thompsonii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 562 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF1 562 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Castilleja thompsonii là loài thực vật có hoa thuộc họ Cỏ chổi. Loài này được Pennell mô tả khoa học đầu tiên năm 1947.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.06 mg

Seed mass max0.06 mg

Seed mass min0.06 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Castilleja thompsonii has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences4

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG217767.1 ↗252 bpCanada · 1994

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAANGCAAGTTGCGCCCAAAGCCATTTGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATC …

Castilleja thompsonii voucher CCDB-24910-H08 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Castilleja thompsonii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — NA

n 121×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — NA

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 562 records

Wild obs. + sensor1 295

Museum / vouchered267

Origin

Native4

Range

Area of Occupancy AOO2 408 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 916≤1 km 68≤10 km 25>10 km 30

1 039 georeferenced · 256 without coordinates

Open the mapobservation + sensor1 295

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 26≤1 km 47≤10 km 74>10 km 8

155 georeferenced · 112 without coordinates

Open the institutions mapphysical evidence267

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	149
Victoria, CA	25
Pullman, US	21
Moscow, US	18
Vancouver, CA	17
Provo, US	8
Bronx, US	5
Corvallis, US	4
University of Stellenboschlocation not on record	3
Cambridge, US	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
University of Alberta Museumslocation not on record	2
University of British Columbia, Herbariumlocation not on record	2
Boise, US	1
San Bernardino, US	1
Bend, US	1
Tampa, US	1
Santa Barbara, US	1
ASUlocation not on record	1
Bangkok, TH	1

20 institutions · 265 of 267 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Castilleja thompsonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

infrequent on dry roadside banks in open sag…in montane grassland dominated by Stipa rich…In Artemisia tridentata/Selaginella densa co…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.3 °C 12.2–18.3

Seasonal swing summer↔winter22.9 °C

Max temp (day)21.8 °C 19.3–24.2

Min temp (night)8.60 °C 5.70–11.4

Precipitation48.9 mm/mo 43.6–54.1

Air humidity51.3 % 50.6–52.0

Moisture balance-87.2 mm/mo -95.6–-78.7

Vapour deficit877 Pa 698–1,056

Wind speed2.20 m/s 1.90–2.60

Cloud cover36.4 % 35.2–37.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Castilleja thompsonii

At a glance

Sources9 archives

Size & morphology3

Life cycle & reproduction2

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 562 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 562 records