Castilleja pilosa — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Orobanchaceae/Castilleja

At a glance

Occurrence records594

Data sources10

Biological traits12

DNA specimens1

eDNA detections3

Sources10 archives

Databases and archives Castilleja pilosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility594 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF594 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Castilleja pilosa is a species of Indian paintbrush known by the common name parrothead Indian paintbrush. It is native to the western United States from California to Wyoming, where it grows in mountain and plateau habitat across the Great Basin and surrounding regions. It is known from sagebrush scrub to high mountains in alpine climates.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.146 mg

⚠ sources differ — TRY: 0.146 mg · GIFT: 0.115 mg

Seed mass max0.115 mg

Seed mass min0.115 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Castilleja pilosa has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEF103690.1 ↗688 bp

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAGAGCAGACCGCGCACACGTTAAACCAAACAAGGCACGTGGCCCGG …

Castilleja pilosa 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL2ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Castilleja pilosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 122×CCDB · book-ipcn75-78 · CCDB · Cave1958

CCDB · book-ipcn75-78 — Heckard & Chuang 1977

CCDB · Cave1958 — Heckard 1958

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type594 records

Wild obs. + sensor237

Museum / vouchered357

Origin

Native18

Range

Area of Occupancy AOO1 560 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 141≤1 km 30≤10 km 13>10 km 7

191 georeferenced · 46 without coordinates

Open the mapobservation + sensor237

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 6≤1 km 108≤10 km 71>10 km 7

192 georeferenced · 165 without coordinates

Open the institutions mapphysical evidence357

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions33 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	43
Claremont, US	22
CASlocation not on record	22
Bronx, US	18
Riverside, US	18
Davis, US	16
Corvallis, US	16
Los Angeles, US	13
Santa Barbara, US	12
Arcata, US	12
San Diego, US	9
University of Stellenboschlocation not on record	6
Bend, US	5
San Jose, US	5
Angwin, US	5
San Luis Obispo, US	4
Moscow, US	4
Chapel Hill, US	4
San Francisco, US	3
Bloomington, US	3
Henderson, US	3
Flagstaff, US	2
Pullman, US	2
Boise, US	2
US	2
Tampa, US	2
Tacoma, US	1
VALElocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Missoula, US	1
Caldwell, US	1
Fredericton Stock Culture Collectionlocation not on record	1
Logan, US	1
Truckee, US	1
WTUlocation not on record	1
Musee des Dinosaures d'Esperaza (Aude)location not on record	1
SEFlocation not on record	1
Provo, US	1
Whitewater, US	1
EL PASO, US	1
Severin-McDaniel Insect Collectionlocation not on record	1
Ashland, US	1
Santa Cruz, US	1

43 institutions · 270 of 357 vouchered records shown · 87 without an institution code

09Environmental DNA3 detections

Where the DNA of Castilleja pilosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Hillside meadow with sagebrush, grass, Fraga…sagebrush, no Alyssum or cheatgrass, found o…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 12.6–14.5

Seasonal swing summer↔winter24.5 °C

Max temp (day)20.8 °C 19.9–21.6

Min temp (night)6.30 °C 5.20–7.30

Precipitation71.0 mm/mo 62.8–79.2

Air humidity47.9 % 46.3–49.6

Moisture balance-82.8 mm/mo -87.0–-78.6

Vapour deficit815 Pa 793–837

Wind speed4.10 m/s 3.00–5.20

Cloud cover23.3 % 23.1–23.4

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.