Castilleja parviflora

Bong. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Orobanchaceae/Castilleja

At a glance

Occurrence records1 086

Data sources12

Biological traits6

DNA specimens3

eDNA detections2

Sources12 archives

Databases and archives Castilleja parviflora's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 086 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Occurrence & distributionGBIF1 086 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT · NCBI≈901 Mbp

01Narrative

Castilleja parviflora is a species of Indian paintbrush known by the common name mountain Indian paintbrush. It is native to western North America from Alaska to California, where it grows in high mountain habitat, including areas of alpine climate.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Habitat & environment4

Climatesubalpine or subarctic

Climberself-supporting

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Subshrub, Forb/herb

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Castilleja parviflora has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPX856785.1 ↗302 bpUSA · 2020

ACGT

TGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCC …

Castilleja parviflora isolate LLV19 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★rbcLa★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Castilleja parviflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈901 230 536 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Castilleja parviflora0.90 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 125×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 +1

CCDB · ipcn-api-dl — Chambers, K. L., D. Green, S. Potampa & L. McMahan. 1998. IOPB chromosome data 13. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 29: 18–22.

CCDB · ipcn-api-dl — Reveal, J. L. & R. Spellenberg. 1976. Miscellaneous chromosome counts of Western American plants - III. Rhodora 78: 37–52.

CCDB · book-ipcn67-71 — HECKARD, L.R. 1968. Chromosome numbers and polyploidy in Castilleja (Scrophulariaceae). Brittonia 20: 212-226.

CCDB · book-ipcn73-74 — POJAR, J. 1973. Levels of polyploidy in four vegetation types of southwestern British Columbia. Canad. J. Bot. 51: 621-628. I

CCDB · Cave1962 — Beaman et al. 1962

n 241×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Baker, M. A. & B. D. Parfitt. 1982. In IOPB chromosome number reports LXXVII. Taxon 31: 764–765.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type1 086 records

Wild obs. + sensor919

Museum / vouchered167

Origin

Native2

Range

Area of Occupancy AOO2 024 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 537≤1 km 95≤10 km 46>10 km 23

701 georeferenced · 218 without coordinates

Open the mapobservation + sensor919

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 13≤1 km 32≤10 km 29>10 km 5

79 georeferenced · 88 without coordinates

Open the institutions mapphysical evidence167

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Victoria, CA	51
University of Alberta Museumslocation not on record	16
Fredericton Stock Culture Collectionlocation not on record	15
Tacoma, US	14
Moscow, US	8
Vancouver, CA	6
Claremont, US	6
Riverside, US	4
Whitehorse, CA	4
Anchorage, US	3
Philadelphia, US	2
Kew, GB	2
Chapel Hill, US	2
Arcata, US	2
WTUlocation not on record	2
Mississippi State, US	2
Santa Barbara, US	2
Davenport, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Portland, US	1
DOI/NPS, Mount Rainier National Parklocation not on record	1
ASUlocation not on record	1
Severin-McDaniel Insect Collectionlocation not on record	1
Toronto, CA	1
Bangkok, TH	1
Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record	1
Long Beach, US	1
DOI/NPS, Greenbelt Parklocation not on record	1
University of Stellenboschlocation not on record	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Turlock, US	1
San Angelo, US	1
Wellington, NZ	1
CASlocation not on record	1
Logan, US	1
Moscow State Universitylocation not on record	1
Columbia, US	1
Tampa, US	1

38 institutions · 162 of 167 vouchered records shown · 5 without an institution code

09Environmental DNA2 detections

Where the DNA of Castilleja parviflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Dry hilly barren area dominated by ponderosa…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.1 °C 11.1–11.1

Seasonal swing summer↔winter23.3 °C

Max temp (day)17.2 °C

Min temp (night)4.80 °C

Precipitation27.6 mm/mo

Air humidity50.8 %

Moisture balance-93.6 mm/mo

Vapour deficit651 Pa

Wind speed1.30 m/s

Cloud cover43.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Castilleja parviflora

At a glance

Sources12 archives

Life cycle & reproduction2

Habitat & environment4

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type1 086 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions25 of 38 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 086 records