Castilleja minor — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Orobanchaceae/Castilleja

At a glance

Occurrence records789

Data sources11

Biological traits13

DNA specimens5

eDNA detections2

Sources11 archives

Databases and archives Castilleja minor's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility789 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF789 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Castilleja minor is a species of flowering plant in the family Orobanchaceae known by the common name lesser Indian paintbrush. It is native to western North America from British Columbia to California to New Mexico, where it grows in moist habitats such as spring meadows.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Seed mass0.134 mg

Seed mass max0.138 mg

Seed mass min0.13 mg

Life cycle & reproduction3

Life formhemiparasitic annual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition3 compounds

Compounds documented for Castilleja minor across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Iridoids monoterpenoids2

Cinnamic acids and derivatives $ Phenylethanoids1

Documented compounds3 total

Compound	Amount	Source
8-Epiloganic Acid	present	LOTUS
Shanzhiside Methyl Ester	present	LOTUS
Verbascoside	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Castilleja minor has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes5

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG218405.1 ↗352 bpUSA · 1888

ACGT

TGCAGNATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATC …

Castilleja minor voucher CCDB-24918-C11 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matKrbcL1rbcLaITS1ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type789 records

Wild obs. + sensor629

Museum / vouchered160

Origin

Native10

Range

Area of Occupancy AOO1 896 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 348≤1 km 34≤10 km 18>10 km 20

420 georeferenced · 209 without coordinates

Open the mapobservation + sensor629

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 15≤1 km 35≤10 km 22>10 km 9

81 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence160

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions32 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Flagstaff, US	22
Claremont, US	19
Phoenix, US	12
Bronx, US	11
Turlock, US	10
ASUlocation not on record	8
DOI/NPS, Colonial National Historical Parklocation not on record	7
Albuquerque, US	7
Musee des Dinosaures d'Esperaza (Aude)location not on record	6
EL PASO, US	5
WTUlocation not on record	4
San Diego, US	3
Riverside, US	3
San Jose, US	2
Bureau of Land Management, Caliente Field Officelocation not on record	2
Tacoma, US	2
CASlocation not on record	2
Moscow, US	2
Wuzhou, CN	2
USFSlocation not on record	2
Grand Junction, US	2
Bloomington, US	2
Tampa, US	2
Angwin, US	2
Davis, US	2
Chadron, US	2
Davenport, US	1
Logan, US	1
Wlocation not on record	1
Pullman, US	1
Philadelphia, US	1
Mississippi State, US	1
San Angelo, US	1
Austin, US	1
Northridge, US	1
Hermosillo, MX	1
Santa Barbara, US	1
US	1
University of Stellenboschlocation not on record	1
Long Beach, US	1
Edinburgh, GB	1

41 institutions · 158 of 160 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Castilleja minor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

in shade of burned Quercus agrifolia. Epilob…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.1 °C 27.1–27.1

Seasonal swing summer↔winter16.8 °C

Max temp (day)35.6 °C

Min temp (night)19.4 °C

Precipitation7.80 mm/mo

Air humidity47.0 %

Moisture balance-220 mm/mo

Vapour deficit1,898 Pa

Wind speed3.50 m/s

Cloud cover15.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.